WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: head mesodermal cell; Larval Expression: head mesodermal cell; Primary Identifier  Expr5778
Remark  Strain: BC13122 Reporter Gene  [F16H11.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TAAAGGCGTGGTACAACAGTAAAA] 3' and primer B 5' [TGAAAAATCAAACAATGAAAGGAA] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

1 Anatomy Terms

Definition Name Synonym Primary Identifier
Head mesodermal cell, function unknown head mesodermal cell hmc WBbt:0004697

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00017530 mfsd-12 F16H11.1 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023