WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Primary Identifier  Expr6608 Remark  Also expressed in (comments from author) : No comments. Strain: BC13471
Reporter Gene  [nas-15::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCAAACAATCTTCGCTTTTTATTC] 3' and primer B 5' [CCGCACTTGATGTCATGTCTA] 3'.

0 Anatomy Terms

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00003534 nas-15 T04G9.2 Caenorhabditis elegans

0 Life Stages