WormMine: ExpressionPattern Expr6028

• Pattern: Adult Expression: pharynx; anal depressor muscle; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; unidentified cells in tail ; Larval Expression: pharynx; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; unidentified cells in tail
• Primary Identifier: Expr6028
• Remark: Strain: BC13675
• Reporter Gene: [F41E6.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGAGCTCCAAAATGACAAGCA] 3' and primer B 5' [TTTTGTGTCCGAGATTCCTTAAA] 3'.

9 Anatomy Terms

Definition	Name	Synonym	Primary Identifier
neuron with cell body associated with the ventral nerve cord.	ventral cord neuron	ventral cord motoneuron	WBbt:0005300
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities.	nervous system		WBbt:0005735
the feeding organ, a neuro-muscular pump in the head of the animal, used to ingest food, bacteria suspended in liquid, filter them out, grind them up and transport posteriorly into the instestine.	pharynx	esophagus	WBbt:0003681
neuron with its cell body situated in the head, excluding the pharynx.	head neuron		WBbt:0006751
a single, H-shaped cell which lies just above the anus and connects the roof of the anal canal to the dorsal bodywall; its contractions act to increase the size of the anal opening by lifting the roof of the rectum and hence facilitate expulsion of intestinal contents.	anal depressor muscle	dilator muscle	WBbt:0004292
neuron with its cell body situated in the tail, posterior to rectum.	tail neuron		WBbt:0006759
H-shaped cell associated with the excretory system, largest cell in C. elegans.	excretory cell	excretory canal cell	WBbt:0005812
the most extensive region of neuropil in the animal, consists of a large toroidal bundle of processes.	nerve ring	circumpharyngeal nerve ring	WBbt:0006749
posterior region, from rectum to the end	tail		WBbt:0005741

1 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00018285	smk-1	F41E6.4	Caenorhabditis elegans

2 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	The stage that begins when a C.elegans individual is fully-developed and has reached maturity.		adult Ce	WBls:0000041
	A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood.		larva Ce	WBls:0000023