WormMine: RNAi WBRNAi00114456

• WormBase ID: WBRNAi00114456
• Genotype: GFP-histone H2B; GFP-gamma-tubulin
• Phenotype Remark: quoted from paper: "The spindle poles rapidly and prematurely separated, and no anaphase chromosome segregation was observed (Fig. 1A, 200/210-sec panels)."
• Remark: knl-1 (WBGene00002231) RNAi; primer 1: ccatgctaatgtcttcacacg, primer 2: ccgctgaaatggatacgagt, amplified from N2 genomic DNA

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Data Sets

• WormBaseAcedbConverter

1 Inhibits Gene

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00002231	knl-1	C02F5.1	Caenorhabditis elegans

1 Inhibits Predicted Gene

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:C02F5.1	C02F5.1	3033	III: 8250636-8250781

0 Laboratories

1 Phenotype

Identifier	Name	Description
WBPhenotype:0001378	mitotic chromosome segregation variant	Any variation in the cell cycle process whereby replicated homologous chromosomes are organized and then physically separated and apportioned to two sets during the mitotic cell cycle compared to control animals.

0 Phenotype _ Not _ Observed

1 Reference

First Author	Title	Year	Journal	Volume	Pages	PubMed ID
						WBPaper00006142

0 Strain