WormMine: RNAi WBRNAi00088920

• WormBase ID: WBRNAi00088920
• Phenotype Remark: RNAi caused complete embryonic lethality. Most nuclei of dying embryos had two 5S ribosomal DNA (rDNA) fluorescence in situ hybridization (FISH) signals, indicating normal chromosome segregation. Occasional nuclei had more than two FISH signals, perhaps from the premature dissociation of sister chromatids.
• Remark: paper remark: Exact sequence used for RNAi not stated by authors, genomic sequence of gene used for curation. Primers used were scc-3 5' GCGTAATACGACTCACTATAGGGTACCGAAACCCTCATCCCTCTCATTCCTCG 3' and 5' GCGTAATACGACTCACTATAGGGATCTTGTCCTGTGCCAATAACTTCCCG.

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Data Sets

• WormBaseAcedbConverter

1 Inhibits Gene

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00004738	scc-3	F18E2.3	Caenorhabditis elegans

1 Inhibits Predicted Gene

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:F18E2.3	F18E2.3	3291	V: 12763945-12764042

1 Laboratories

Primary Identifier
TY

1 Phenotype

Identifier	Name	Description
WBPhenotype:0000050	embryonic lethal	Animals die during embryonic development. In C. elegans, often assayed as refractile eggs that fail to hatch; when applied to large-scale RNAi screens in C. elegans, more than 10% of embryos die.

1 Phenotype _ Not _ Observed

Identifier	Name	Description
WBPhenotype:0000773	chromosome segregation variant	Any variation in the processes that regulate the apportionment of chromosomes to each of two daughter cells compared to control.

1 Reference

First Author	Title	Year	Journal	Volume	Pages	PubMed ID
						WBPaper00005919

0 Strain