WormMine: Gene WBGene00000229

• WormBase Gene ID: WBGene00000229
• Gene Name: atp-2
• Sequence Name: C34E10.6
• Brief Description: atp-2 encodes the beta subunit of the soluble, catalytic F1 portion of ATP synthase (mitochondrial respiratory chain [MRC] complex V); atp-2 activity is required for embryonic and larval development past the L3 stage, as well as for normal mobility, pharyngeal pumping, defecation, growth rate, and larval lifespan; in males, atp-2 activity is also required cell autonomously in male-specific sensory neurons for response to hermaphrodite contact, the first step in a series of stereotypical male mating behaviors; in vitro, the N-terminus of ATP-2 interacts directly with the conserved PLAT domains of human polycystin (PC)-1 and C. elegans LOV-1, which is expressed exclusively in adult male sensory neurons and is also required for the response to hermaphrodite contact; atp-2 is widely expressed throughout development in both sexes; ATP-2 localizes to mitochondria and to cilia of male-specific neurons; in the male-specific CEM neurons ATP-2 colocalizes with PKD-2, the C. elegans homolog of human polycystin (PC)-2.
• Organism: Caenorhabditis elegans
• Automated Description: Enables protein domain specific binding activity. Involved in several processes, including determination of adult lifespan; inductive cell migration; and nematode pharyngeal pumping. Located in mitochondrion and non-motile cilium. Expressed in HOB; head; ray neuron type B; and tail. Is an ortholog of human ATP5F1B (ATP synthase F1 subunit beta).
• Biotype: SO:0001217
• Genetic Position: III :-1.91727 ±0.020951
• Length (nt): 2120

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00000229

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:C34E10.6.1	C34E10.6.1	1929	III: 5228417-5230536
Transcript:C34E10.6.2	C34E10.6.2	1846	III: 5228417-5230532

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:C34E10.6	C34E10.6	1617	III: 5228428-5228518

64 RNAi Result

• WBRNAi00095517
• WBRNAi00096590
• WBRNAi00096593
• WBRNAi00096682
• WBRNAi00096685
• WBRNAi00096688
• WBRNAi00096691
• WBRNAi00096694
• WBRNAi00096734
• WBRNAi00096737
• WBRNAi00096740
• WBRNAi00067279
• WBRNAi00067345
• WBRNAi00068081
• WBRNAi00063778
• WBRNAi00063779
• WBRNAi00063768
• WBRNAi00085511
• WBRNAi00008487
• WBRNAi00116376
• WBRNAi00066288
• WBRNAi00065009
• WBRNAi00090934
• WBRNAi00071278
• WBRNAi00111110
• WBRNAi00110108
• WBRNAi00112745
• WBRNAi00066144
• WBRNAi00066258
• WBRNAi00024734

29 Allele

• WBVar01607038
• gk446075
• WBVar01893346
• gk174288
• gk174287
• gk174290
• gk174289
• ok3002
• gk174286
• ua2
• gk724836
• gk568286
• gk399701
• gk344533
• gk487526
• gk568285
• gk317632
• gk713146
• gk887173
• gk474638
• WBVar00056221
• WBVar01995189
• h13731
• gk958851
• gk958852
• WBVar01644609
• WBVar01445660
• WBVar01644610
• WBVar01445659

1 Chromosome

• WormBase ID: III
• Organism: Caenorhabditis elegans
• Length (nt): 13783801

1 Chromosome Location

• Feature . Primary Identifier: WBGene00000229
• Start: 5228417
• End: 5230536
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrIII_5230537..5230554
• Length (nt): 18
• Chromosome Location: III: 5230537-5230554
• Organism: Caenorhabditis elegans

199 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	oocyte proteins identified by two or more unique peptides during proteomics study.	In the pooled data set, 1453 C. elegans proteins were identified with a probability >= 0.9 according to ProteinProphet, of which 1165 proteins were identified by more than one unique peptide.	WBPaper00038289:oocyte_protein
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when no food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_NoFood
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:bodywall-muscle_L1-larva_expressed
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141)
	Transcripts detected in germline isolated from day-1 adult hermaphrodite animals.	All three experiments have CPM >= 1.	WBPaper00067147:germline_expressed
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
	Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage.	DESeq2 version 1.22.2, p < 0.05	WBPaper00064716:paraquat_downregulated
	Transcripts that showed significantly decreased expression in N2 day 10 adults comparing to in N2 day 1 adult animals according to Illumina RNASeq.	DESeq fold change > 2, FDR < 0.05.	WBPaper00067499:Day10_vs_Day1_downregulated_Illumina
	Transcripts that showed significantly decreased expression in N2 day 15 adults comparing to in N2 day 1 adult animals according to Illumina RNASeq.	DESeq fold change > 2, FDR < 0.05.	WBPaper00067499:Day15_vs_Day1_downregulated_Illumina
	Transcripts depleted in purified oocyte P bodies comparing to in whole oocytes.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_oocyte_depleted
	Transcripts depleted in purified oocyte P bodies comparing to in the whole animal.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_WholeAnimal_depleted
	Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy.	Cufflinks	WBPaper00065120:body-muscle-transcriptome
Bacteria infection: Pseudomonas aeruginosa PA14. 24 hours of exposure at 25C.	Transcripts that showed significantly increased expression in N2 animals with 24 hours of exposure to P. aeruginosa PA14 for 24 hrs at 25C, comparing to N2 animals without exposure to PA14.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00058948:PA14_upregulated

11 Expression Patterns

• Primary Identifier: Expr5420
• Remark: Also expressed in (comments from author) : high intensity GFP, other tissues may have been masked Strain: BC13747
• Reporter Gene: [atp-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGAATTCTGCACTGCAATCAC] 3' and primer B 5' [TAACGAACGCGAAGCGATA] 3'.
• Pattern: Adult Expression: pharynx; anal depressor muscle; Reproductive System; vulval muscle; body wall muscle; hypodermis; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; Larval Expression: pharynx; anal depressor muscle; body wall muscle; hypodermis; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons

• Primary Identifier: Expr5421
• Remark: Also expressed in (comments from author) : Intense GFP expression made it hard to resolve some tissues. Strain: BC10161
• Reporter Gene: [atp-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGAATTCTGCACTGCAATCAC] 3' and primer B 5' [TAACGAACGCGAAGCGATA] 3'.
• Pattern: Adult Expression: pharynx; stomato-intestinal muscle; anal depressor muscle; Reproductive System; vulval muscle; body wall muscle; hypodermis; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; unidentified cells in head; unidentified cells in body ;unidentified cells in tail ; Larval Expression: pharynx; stomato-intestinal muscle; anal depressor muscle; body wall muscle; hypodermis; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; unidentified cells in head; unidentified cells in body ;unidentified cells in tail

• Primary Identifier: Expr5419
• Remark: Strain: DM13747
• Reporter Gene: [atp-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGAATTCTGCACTGCAATCAC] 3' and primer B 5' [TAACGAACGCGAAGCGATA] 3'.
• Pattern: Adult Expression: pharynx; intestine; stomato-intestinal muscle; Reproductive System; spermatheca; body wall muscle; Nervous System; nerve ring; ventral nerve cord; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; intestine; stomato-intestinal muscle; body wall muscle; Nervous System; nerve ring; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr2009510
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1030146
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr3208
• Pattern: lov-1 and atp-2 are coexpressed in the tail ray B neurons and HOB hook neuron as well as the male-specific CEM head neurons.
• Subcellular Localization: ATP-2::GFP is found in a broad range of tissue types, making it difficult to ascertain ciliary localization. To look more carefully at ATP-2 subcellular localization, we examined colocalization of ATP-2 and PKD-2. LOV-1 and PKD-2 exhibit identical subcellular localization patterns. PKD-2::DsRed2 localizes to cilia and cell bodies of ray, HOB, and CEM neurons. ATP-2::GFP clearly colocalizes with PKD-2::DsRed2 in CEM cilia. In rays and HOB, ciliary colocalization of ATP-2 and PKD-2 was ambiguous due to the expression of ATP-2::GFP in ray neurons, support cells, and hypodermis.

• Primary Identifier: Chronogram155
• Remark: Original chronogram file: chronogram.116.xml
• Reporter Gene: [C34E10.6:gfp] transcriptional fusion.

• Primary Identifier: Expr1023708
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr2027747
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1145903
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Chronogram2037
• Remark: Original chronogram file: chronogram.947.xml
• Reporter Gene: [C34E10.6:gfp] transcriptional fusion.

42 GO Annotation

7 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00000229
• Start: 5228417
• End: 5230536
• Strand: 1

42 Ontology Annotations

3 Regulates Expr Cluster

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in glp-4(bn2);atp-2(RNAi), comparing to in glp-4(bn2) animals injected with empty vector.	Cufflinks 2.2.1	WBPaper00060278:atp-2(RNAi)_upregulated
	Transcripts that showed significantly increased expression in atp-2(RNAi) comparing to in N2 animals fed with empty vector.	N.A.	WBPaper00066633:atp-2(RNAi)_upregulated
	Transcripts that showed significantly decreased expression in atp-2(RNAi) comparing to in N2 animals fed with empty vector.	N.A.	WBPaper00066633:atp-2(RNAi)_downregulated

1 Sequence

• Length: 2120

1 Sequence Ontology Term

• Name: gene

5 Strains

• WBStrain00024105
• WBStrain00024104
• WBStrain00037206
• WBStrain00001205
• WBStrain00006141

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrIII_5227885..5228416
• Length (nt): 532
• Chromosome Location: III: 5227885-5228416
• Organism: Caenorhabditis elegans