WormMine: Gene WBGene00000307

• WormBase Gene ID: WBGene00000307
• Gene Name: Cbr-bli-4
• Sequence Name: CBG12593
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable serine-type endopeptidase activity. Predicted to be involved in proteolysis. Is an ortholog of C. elegans bli-4. In C. elegans, bli-4 is involved in several processes, including cellular response to salt; collagen and cuticulin-based cuticle development; and positive regulation of synaptic assembly at neuromuscular junction.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG12593.1	CBG12593.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG12593	CBG12593		[unknown]

0 RNAi Result

7 Allele

• WBVar00118687
• WBVar00118689
• WBVar00118688
• WBVar00118691
• WBVar00118690
• WBVar00118693
• WBVar00118692

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1053197
• Remark: Cbr-bli-4, AAGATTTCAATGCAAATGGGTTCCACAAATGGCCATTCCTCTCGGTTCAACAATGGGGAG, WBGene00000307
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region