WormMine: Gene WBGene00000328

• WormBase Gene ID: WBGene00000328
• Gene Name: Cbr-fem-2
• Sequence Name: CBG15267
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable protein serine/threonine phosphatase activity. Is an ortholog of C. elegans fem-2. In C. elegans, fem-2 is involved in male sex determination; masculinization of hermaphroditic germ-line; and nematode male tail tip morphogenesis.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG15267.1	CBG15267.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG15267	CBG15267		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1057145
• Remark: Cbr-fem-2, GTGGTCAACTGTTTGTGATTGGTGGAGAGCTTCGAGTGAATGGTGTGCTCAATCTGACAC, WBGene00000328
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

2 Strains

• WBStrain00040965
• WBStrain00040962

0 Upstream Intergenic Region