WormMine

WS296

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00000446 Gene Name  ceh-23
Sequence Name  ? ZK652.5 Brief Description  ceh-23 encodes a homeodomain protein required for a specific differentiated trait of the thermosensory interneuron AIY; a ceh-23::gfp promoter fusion is expressed in nine pairs of head neurons, including seven amphid sensory neurons, the BAG sensory neurons, AIY interneurons, and the CAN neurons that are in close association with the excretory canal.
Organism  Caenorhabditis elegans Automated Description  Predicted to enable DNA-binding transcription factor activity, RNA polymerase II-specific and RNA polymerase II cis-regulatory region sequence-specific DNA binding activity. Involved in determination of adult lifespan; neuron differentiation; and regulation of gene expression. Located in nucleus. Expressed in intestine; nervous system; and tail.
Biotype  SO:0001217 Genetic Position  III :-0.563901 ±0.005495
Length (nt)  ? 1900
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00000446

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:ZK652.5.1 ZK652.5.1 1044   III: 7839592-7841491
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:ZK652.5 ZK652.5 918   III: 7839594-7839666

7 RNAi Result

WormBase ID
WBRNAi00113225
WBRNAi00059619
WBRNAi00022105
WBRNAi00005631
WBRNAi00038397
WBRNAi00112995
WBRNAi00113116

22 Allele

Public Name
gk964518
gk963887
WBVar01995556
gk818636
gk179043
gk543728
WBVar01408921
gk558813
gk872494
ms23
gk955830
gk444101
gk847741
WBVar01446893
WBVar01446894
WBVar01838146
gk179040
gk179039
gk179042
gk179041
WBVar01995557
WBVar00236668

1 Chromosome

WormBase ID Organism Length (nt)
III Caenorhabditis elegans 13783801  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00000446 7839592 7841491 1

4 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  
Panther orthologue and paralogue predictions  

1 Downstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrIII_7841492..7842134   643 III: 7841492-7842134 Caenorhabditis elegans

107 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in ogt-1(ok1474) neuronal cells isolated by FACs comparing to in FACs isolated neuronal cells from wild type. DESeq2, fold change > 2, FDR < 0.05. WBPaper00066485:ogt-1(ok1474)_upregulated_neuron
  Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells. DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction. WBPaper00060811:L1_vs_adult_upregulated_neural
  Transcripts of coding genes that showed significantly decreased expression in muscle. DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed. WBPaper00062325:muscle_depleted_coding-RNA
  Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. DESeq. False discovry rate (FDR) < 0.1. WBPaper00048988:neuron_expressed
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
Osmotic stress Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present DESeq(version 1.10.1), FDR < 0.05. WBPaper00050726:OsmoticStress_regulated_Food
  Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology. DESEQ2, fold change > 2 and FDR < 0.01. WBPaper00062103:neuron_enriched
Osmotic stress Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when no food was present DESeq(version 1.10.1), FDR < 0.05. WBPaper00050726:OsmoticStress_regulated_NoFood
  Transcripts that showed significantly increased expression in csr-1a(tor159) comparing to in N2 at 25C. DESeq2, fold change > 2, p-value < 0.05. WBPaper00061753:csr-1(tor159)_upregulated_25C
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:A-class-motor-neurons_L2-larva_expressed
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:all-neurons_L2-larva_expressed
  Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals. DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2. WBPaper00062159:hda-2(ok1479)_upregulated
  Transcripts that showed significantly decreased expression in eat-2(ad1116) comparing to in N2 at 3-days post L4 adult hermaphrodite animals. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:eat-2(ad1116)_downregulated
  Transcripts that showed significantly decreased expression after animals were treated with 100uM Psora and 250uM Allantoin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Psora-Allantoin_downregulated
  Transcripts that showed significantly increased expression in dpy-21(e428) comparing to in N2 during L3 stage. DESeq v1.6.3. Fold change > 1.5. WBPaper00050370:dpy-21(e428)_L3_upregulated
  Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin and 50mM Metformin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Rapamycin-Metformin_downregulated
  Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin and 50uM Rifampicin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Rapamycin-Rifampicin_downregulated
  Transcripts that showed significantly decreased expression after animals were treated with 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Rifampicin-Allantoin_downregulated
  Transcripts that showed significantly decreased expression after animals were treated with 50uM Rifampicin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Rifampicin_downregulated
  Transcripts that showed significantly increased expression in ilc-17.1(syb5296) comparing to in N2 animals at L4 larva stage. DESeq2, fold change > 2, FDR < 0.05. WBPaper00066594:ilc-17.1(syb5296)_upregulated
  Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(+), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage. DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2. WBPaper00050859:upregulated_P-granule(-)GFP(+)_vs_control_day2-adult
  Genes found to be regulated by low-copy overexpression of sir-2.1 with p < 0.014. N.A. WBPaper00026929:sir-2.1_overexpression_regulated
  Transcripts that showed significantly increased expression in lin-22(ot269) comparing to in N2 at L3 larva. Differences in gene expression were then calculated using the negative binomial test in the DESeq package (FDR = 0.1). WBPaper00053295:lin-22(ot269)_upregulated
  Transcripts depleted in RIS neurons comparing to in all cells. edgeR 3.24.3, FDR < 0.01 WBPaper00058969:RIS_depleted
  Transcripts that showed significantly increased expression in nuo-6(qm200);atfs-1(gk3094) comparing to in N2. EdgeR v. 3.20.2, fold change > 2. WBPaper00055941:nuo-6(qm200);atfs-1(gk3094)_upregulated
control(maintained under normal lab light (mostly dark, in incubators).) vs UVC-EtBr-exposed(exposed to 7.5 J/m2 UVC radiation 3 times, 24 h apart (48 h total) and exposed to EtBr (5ug/mL in agar).) at 3 h after the third UVC dose (51h), which is also 3 h after being placed on food. Genes differentially expressed in control vs after UVC exposure and EtBr treatment at the 3h timepoint (3 h after the third UVC dose (51h), which is also 3 h after being placed on food). Transcripts were defined as fold-change >1.2, p < 0.05 based on Rosetta Resolver analysis for all pairwise treatment comparisons. The fold-change refers to the second intensity over the first. WBPaper00041939:control_vs_UVC-EtBr-exposed_51h
  Significantly upregulated genes from cyc-1(RNAi) microarrays using SAM algorithm with an FDR < 0.1 from adult-only chips. SAM algorithm with an FDR < 0.1. WBPaper00033065:cyc-1(RNAi)_upregulated
  Transcripts that showed significantly increased expression in lin-22(icb38) comparing to in N2 at L3 larva. Differences in gene expression were then calculated using the negative binomial test in the DESeq package (FDR = 0.1). WBPaper00053295:lin-22(icb38)_upregulated
  Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin, 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Rapamycin-Rifampicin-Allantoin_downregulated
Bacteria infection: Photorhabdus luminescens Genes with increased expression after 24 hours of infection by P.lumniescens Fold changes shown are pathogen vs OP50. For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated. WBPaper00038438:P.lumniescens_24hr_upregulated_TilingArray

12 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
    Expr1163024 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  
    Expr2009870 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
  [CEH-23::GFP] translational fusion. A 10.3 Kbp genomic fragment containing the 7.3 Kbp sequence upstream of the ceh-23 coding region, the 1.8 Kbp ceh-23 coding region, and the 1.1 Kbp sequence downstream of the ceh-23 coding region was amplified from genomic DNA by PCR. A GFP coding sequence without stop codon was amplified by PCR from the plasmid pPD95-81. The amplified GFP sequence was then fused in frame at the N-terminal of the ceh-23 coding region into the 10.3 Kbp genomic fragment described above. --precise ends. Expr9598 The expression of CEH-23::GFP was restricted to a handful of neurons and the intestine of the worm. Although the neurons in which CEH-23 is expressed have not been identified, the observed neuronal expression of the CEH-23::GFP construct resembles that of a previously published GFP construct fused to a partial CEH-23 (gmIs18[ceh-23::gfp]), which was reported to express in the pair of CAN neurons in the central body and 12 sets of sensory neurons in the head (10 pairs) and the tail (2 pairs). While the neuronal expression of CEH-23 was found in all the transgenic worms, the intestinal expression was only detected in ,50% of the transgenic worms with a stronger expression in the posterior intestine. The expression of CEH-23::GFP was restricted to a handful of neurons and the intestine of the worm. Although the neurons in which CEH-23 is expressed have not been identified, the observed neuronal expression of the CEH-23::GFP construct resembles that of a previously published GFP construct fused to a partial CEH-23 (gmIs18[ceh-23::gfp]), which was reported to express in the pair of CAN neurons in the central body and 12 sets of sensory neurons in the head (10 pairs) and the tail (2 pairs). While the neuronal expression of CEH-23 was found in all the transgenic worms, the intestinal expression was only detected in 50% of the transgenic worms with a stronger expression in the posterior intestine. Enriched nuclear localization of CEH-23 was detected in both the neurons and the intestine.
Clone: pUL#JRH5F1   Expr7764 Expression is seen from late embryo to adult in about 10 cells in the nerve ring; processes to the tip of the head; and two nerves down sides of the body (perhaps canal-associated nerves).  
    Expr15575    
Strain: BC12624 [ceh-23::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAACACCCGAATTATTTGTTCATT] 3' and primer B 5' [GAAGATGGGTGTCGATCTAGAAA] 3'. Expr7241 Adult Expression: Nervous System; head neurons; unidentified cells in tail ; Larval Expression: intestine - posterior cells; Nervous System; head neurons; unidentified cells in tail ;  
Table S1A.   Expr10084 Expressed in AIY.  
    Expr12344 Animals bearing a Pceh-23::gfp transgene expressed GFP in the CANs and in several sensory neurons located in the head and tail.  
    Expr1021192 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
    Expr2028110 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
Original chronogram file: chronogram.1742.xml [ZK652.5:gfp] transcriptional fusion. Chronogram711    
    Expr1170035 Time-lapse fluorescence microscopy was performed, including DIC for morphology. Gene expression patterns were summarized in 4 manners: Average over time, Average over time and at different positions along the anterior-posterior (AP) axis, a voxelized representation over time, and on individual cells overlaid from a reference coordinate dataset (https://doi.org/10.1016/j.ydbio.2009.06.014). The analysis was done with a pipeline based on the multi-purpose image analysis software Endrov (https://doi.org/10.1038/nmeth.2478), which further is needed to browse the raw recording data. Thumbnail movies were also generated, using maximum Z projection for the 3D fluorescence channel. Raw recordings available in the Endrov OST-file format are available at https://www.ebi.ac.uk/biostudies/studies/S-BIAD191?query=S-BIAD191  

15 GO Annotation

Annotation Extension Qualifier
  involved_in
  involved_in
  involved_in
  involved_in
  enables
  involved_in
  enables
  enables
  located_in
  located_in
has input(WB:WBGene00005037),occurs in(WBbt:0005413) involved_in
  located_in
  involved_in
results in acquisition of features of(WBbt:0005413) involved_in
  enables

26 Homologues

Type
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00000446 7839592 7841491 1

15 Ontology Annotations

Annotation Extension Qualifier
  involved_in
  involved_in
  involved_in
  involved_in
  enables
  involved_in
  enables
  enables
  located_in
  located_in
has input(WB:WBGene00005037),occurs in(WBbt:0005413) involved_in
  located_in
  involved_in
results in acquisition of features of(WBbt:0005413) involved_in
  enables

2 Regulates Expr Cluster

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that were repressed by CEH-23 by comparing expression between isp-1(qm150) and ceh-23(ms23);isp-1(qm150). Identified by 1 class SAM with FDR=0.59, 1.5 fold gene cutoff. WBPaper00051304:CEH-23_repressed
  Transcripts that were activated by CEH-23 by comparing expression between isp-1(qm150) and ceh-23(ms23);isp-1(qm150). Identified by 1 class SAM with FDR=0.59, 1.5 fold gene cutoff. WBPaper00051304:CEH-23_activating

1 Sequence

Length
1900

1 Sequence Ontology Term

Identifier Name Description
gene  

14 Strains

WormBase ID
WBStrain00028750
WBStrain00029284
WBStrain00033417
WBStrain00035391
WBStrain00048959
WBStrain00052008
WBStrain00002232
WBStrain00005218
WBStrain00005232
WBStrain00005234
WBStrain00005228
WBStrain00005229
WBStrain00005226
WBStrain00005235

1 Upstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrIII_7832495..7839591   7097 III: 7832495-7839591 Caenorhabditis elegans