WormMine: Gene WBGene00000490

• WormBase Gene ID: WBGene00000490
• Gene Name: che-11
• Sequence Name: C27A7.4
• Brief Description: che-11 encodes a large, unfamiliar protein with orthologs in vertebrates and arthropods (e.g., KIAA0590 and CG11838-PA) and in Chlamydomonas (IFT140), as well as distant similarity to OSM-1 and ZK520.1; che-11 is required for normal synthesis of sensory cilia (via intraflagellar transport) in sensory neurons, osmotic avoidance, and dauer formation.
• Organism: Caenorhabditis elegans
• Automated Description: Involved in several processes, including dauer entry; positive regulation of intracellular transport; and response to stress. Located in non-motile cilium. Expressed in head and neurons. Human ortholog(s) of this gene implicated in retinitis pigmentosa and short-rib thoracic dysplasia 9 with or without polydactyly. Is an ortholog of human IFT140 (intraflagellar transport 140).
• Biotype: SO:0001217
• Genetic Position: V :3.67501 ±0.005038
• Length (nt): 6464

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00000490

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:C27A7.4.1	C27A7.4.1	4383	V: 12144244-12150707

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:C27A7.4	C27A7.4	4314	V: 12144295-12144634

4 RNAi Result

• WBRNAi00000647
• WBRNAi00041311
• WBRNAi00011237
• WBRNAi00029254

92 Allele

• gk963271
• gk963301
• gk964458
• gk964459
• gk963618
• WBVar02061281
• WBVar02061282
• qa5000
• WBVar01866788
• WBVar01866787
• WBVar01866786
• WBVar01866789
• WBVar01866791
• WBVar01866790
• WBVar01823779
• gk963636
• gk248921
• gk248922
• gk248919
• gk248920
• gk248917
• tm11942
• gk248918
• gk248916
• tm8067
• gk248929
• gk248930
• gk248927
• gk248928
• syb1310

1 Chromosome

• WormBase ID: V
• Organism: Caenorhabditis elegans
• Length (nt): 20924180

1 Chromosome Location

• Feature . Primary Identifier: WBGene00000490
• Start: 12144244
• End: 12150707
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

0 Downstream Intergenic Region

191 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology.	DESEQ2, fold change > 2 and FDR < 0.01.	WBPaper00062103:neuron_enriched
	Single-cell RNA-Seq cell group 71_0 expressed in neuron.	scVI 0.6.0	WBPaper00065841:71_0
Bacteria infection: Enterococcus faecalis	Genes with increased expression after 24 hours of infection by E.faecalis Fold changes shown are pathogen vs OP50.	For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated.	WBPaper00038438:E.faecalis_24hr_upregulated_TilingArray
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_daf-16(mu86);glp-1(e2141)
	Transcripts that showed significantly increased expression in rrf-3(pk1426) comparing to in N2 at embryo stage.	DESeq2v 1.18.1, fold change > 1.5, adjusted p-value < 0.01.	WBPaper00056169:rrf-3(pk1426)_upregulated_embryo
	Transcripts that showed significantly increased expression after four-day-old young adult worms were placed on NGM plates seeded with OP50 in the presence 5% Agaro-oligosaccharides(AGO) for 24 h, comparing to animals grown in the absence of AGO.	Fold change > 2.	WBPaper00064306:Agaro-oligosaccharides_upregulated
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
	Transcripts that showed significantly changed expression in 6-day post-L4 adult hermaphrodite comparing to in 1-day post L4 adult hermaphrodite animals.	Sleuth	WBPaper00051558:aging_regulated
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage.	DESeq	WBPaper00053302:stavudine_24h_regulated
	Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	DESeq2, fold change > 2, adjusted p-value < 0.01	WBPaper00058598:sin-3(tm1276)_downregulated
	Transcripts depleted in purified oocyte P bodies comparing to in the whole animal.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_WholeAnimal_depleted
	Transcripts that showed significantly increased expression in 10-days post L4 adult hermaphrodite npr-8(ok1439) animals grown at 25C, comparing to in N2 animals.	CuffDiff, fold change > 2.	WBPaper00065096:npr-8(ok1439)_upregulated_Day10_25C
	Transcripts that showed significantly increased expression in xrep-4(lax137).	DESeq2. Genes were selected if their p value < 0.01.	WBPaper00066062:xrep-4(lax137)_upregulated
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:coelomocytes_L2-larva_expressed
	Transcripts that showed significantly increased expression in hpk-1(pk1393) comparing to in N2 at adult day 2.	DESeq 2, fold change > 2, FDR < 0.05.	WBPaper00065581:hpk-1(pk1393)_upregulated
	Transcripts that showed significantly increased expression in hda-1(ne4752[3xFLAG-Degron-HDA-1]) in gonads dissected from 1-day old adult animals.	Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R.	WBPaper00061479:hda-1(ne4752)_upregulated
	Transcripts that showed significantly altered expression at URX, AQR, and PQR neurons in camt-1(ok515) animals comparing to in wild type AX1888-1 strain.	RNA-seq data were mapped using PRAGUI - a Python 3-based pipeline for RNA-seq data analysis.	WBPaper00061902:camt-1(ok515)_regulated_URX-AQR-PQR
	Transcripts that showed significantly increased expression in ilc-17.1(syb5296) comparing to in N2 animals at L4 larva stage.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00066594:ilc-17.1(syb5296)_upregulated
	Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals.	DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2.	WBPaper00062159:hda-2(ok1479)_upregulated
	Transcripts that showed significantly increased expression in srbc-48(ac23);kyIs262;fer-1(b232ts) comparing to in kyIs262;fer-1(b232ts), 24h after infection with P.aeruginosa.	DESeq2, FDR <0.05, fold change > 2.	WBPaper00059664:srbc-48(ac23)_upregulated
	Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin and 50mM Metformin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Metformin_downregulated
	Transcripts that showed significantly decreased expression after animals were treated with 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin-Allantoin_downregulated
	Transcripts that showed significantly decreased expression in set-2(tm1630) animals at embryo stage, comparing to in N2 animals.	DESeq2 (v2.1.8.3) was used to determine DE genes and to generate principal component and scatter plots. DE genes with FDR < 0.05 were analysed using g:Profiler with Bonferroni correction.	WBPaper00060014:set-2(tm1630)_downregulated
	Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(+), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage.	DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2.	WBPaper00050859:upregulated_P-granule(-)GFP(+)_vs_control_day2-adult

9 Expression Patterns

• Primary Identifier: Expr4408
• Remark: No detailed description on cellular expression pattern in other tissue or life stage.
• Pattern: Expressed in amphid and phasmid neurons.

• Primary Identifier: Expr5349
• Remark: Strain: BC13494
• Reporter Gene: [che-11::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TAACAACGCAGAAAAGTGTAGCA] 3' and primer B 5' [TCTTTCCATCCTACTACCACGAA] 3'.
• Pattern: Adult Expression: body wall muscle; Larval Expression: body wall muscle; unidentified cells in head

• Primary Identifier: Expr2009960
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1030288
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr10130
• Remark: Promoter::GFP fusion constructs of variable lengths were generated using PCR amplification followed by subsequent cloning into expression vectors.
• Pattern: Expressed in both the amphid and tail ciliated sensory neurons. The 60 C. elegans CSNs present in an adult hermaphrodite worm were divided into 5 subgroups or anatomical regions including, neurons that reside in the amphids (region 1 = 24 CSNs: AWAL/R, AWBL/R, AWCL/R, AFDL/R, ASEL/R, ADFL/R, ASGL/R, ASHL/R, ASIL/R, ASJLR, ASKL/R, ADLL/R) or in the tail (region 2 = 5 CSNs: PHAL/R, PHBL/R, PQR), neurons surrounding the anterior bulb (region 3 = 24 CSNs: BAGL/ R, CEPVL/R, CEPDL/R, IL1L/R, IL2L/R, IL1VL/R, IL2VL/R, IL1DL/R, IL2DL/R, OLLL/R, OLQVL/R, OLQDL/R) or the posterior bulb (region 4 = 5 CSNs: ADEL/R, FLPL/R, AQR) of the pharynx, and neurons in the midbody region of the worm (region 5=2 CSNs: PDEL/R). che-11 was detected in region 1 and 2.

• Primary Identifier: Expr2028200
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Chronogram1245
• Remark: Original chronogram file: chronogram.2369.xml
• Reporter Gene: [C27A7.4:gfp] transcriptional fusion.

• Primary Identifier: Expr1145353
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr1025654
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

20 GO Annotation

4 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00000490
• Start: 12144244
• End: 12150707
• Strand: -1

20 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 6464

1 Sequence Ontology Term

• Name: gene

6 Strains

• WBStrain00034362
• WBStrain00034366
• WBStrain00034364
• WBStrain00040626
• WBStrain00006275
• WBStrain00004476

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrV_12150708..12153156
• Length (nt): 2449
• Chromosome Location: V: 12150708-12153156
• Organism: Caenorhabditis elegans