WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00001059 Gene Name  dpf-6
Sequence Name  ? F44B9.1 Organism  Caenorhabditis elegans
Automated Description  Predicted to enable serine-type endopeptidase activity. Predicted to be involved in proteolysis. Predicted to be located in plasma membrane. Biotype  SO:0001217
Genetic Position  III :-0.415901 ±0.006377 Length (nt)  ? 3089
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00001059

Genomics

3 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:F44B9.1a.1 F44B9.1a.1 2444   III: 8038241-8041329
Transcript:F44B9.1c.1 F44B9.1c.1 1722   III: 8038247-8040380
Transcript:F44B9.1b.1 F44B9.1b.1 1536   III: 8039157-8041114
 

Other

3 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:F44B9.1a F44B9.1a 2223   III: 8038247-8038484
CDS:F44B9.1c F44B9.1c 1722   III: 8038247-8038484
CDS:F44B9.1b F44B9.1b 1536   III: 8039157-8039472

5 RNAi Result

WormBase ID
WBRNAi00047246
WBRNAi00014905
WBRNAi00005207
WBRNAi00098185
WBRNAi00089080

41 Allele

Public Name
gk964518
gk963887
gk577676
gk657319
gk535130
gk323272
WBVar01838170
gk796589
gk599264
gk546052
gk179416
gk659808
gk885886
gk179415
gk558815
gk179418
gk871916
gk179417
gk558190
gk179412
gk884860
gk568324
gk179414
gk879101
gk179413
gk644285
gk680947
WBVar01566938
gk616669
gk523977

1 Chromosome

WormBase ID Organism Length (nt)
III Caenorhabditis elegans 13783801  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00001059 8038241 8041329 1

3 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  

1 Downstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrIII_8041330..8042549   1220 III: 8041330-8042549 Caenorhabditis elegans

229 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts of coding genes that showed significantly decreased expression in muscle. DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed. WBPaper00062325:muscle_depleted_coding-RNA
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
  TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood. SAM WBPaper00031040:TGF-beta_adult_upregulated
Osmotic stress Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present DESeq(version 1.10.1), FDR < 0.05. WBPaper00050726:OsmoticStress_regulated_Food
Osmotic stress Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when no food was present DESeq(version 1.10.1), FDR < 0.05. WBPaper00050726:OsmoticStress_regulated_NoFood
  Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals. Fold change > 2, FDR < 0.01. WBPaper00065993:glp-1(e2141)_upregulated
  Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:body-muscle_expressed
  Transcripts that showed significantly decreased expression at 11-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites. DESeq2, fold change > 2, FDR < 0.05 WBPaper00065835:Day11_vs_Day1_downregulated
  Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:hypodermis_expressed
mitochondrial sulfide delivery molecule (mtH2S) AP39 Transcripts that showed significantly increased expression in N2 animals treated with mitochondrial sulfide delivery molecule (mtH2S) AP39 starting from 1-day-post L4 until 11 days post L4. DESeq2, fold change > 2, FDR < 0.05 WBPaper00065835:mtH2S-AP39-D0-treatment_upregulated_Day11
  Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals. Fold change > 2, FDR < 0.05 WBPaper00064088:Day-1-adult_vs_L4_upregulated_daf-16(mu86);glp-1(e2141)
  Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva fem-3(q20) animals. Fold change > 2, FDR < 0.05 WBPaper00064088:Day-1-adult_vs_L4_upregulated_fem-3(q20)
  Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals. Fold change > 2, FDR < 0.05 WBPaper00064088:Day-1-adult_vs_L4_upregulated_glp-1(e2141)
  Transcripts that showed significantly increased expression in day 3 adult hermaphrodite comparing to in L4 larva fem-3(q20) animals. Fold change > 2, FDR < 0.05 WBPaper00064088:Day-3-adult_vs_L4_upregulated_fem-3(q20)
  Transcripts that showed significantly increased expression in rrf-3(pk1426) comparing to in N2 at embryo stage. DESeq2v 1.18.1, fold change > 1.5, adjusted p-value < 0.01. WBPaper00056169:rrf-3(pk1426)_upregulated_embryo
Bacteria infection: Bacillus thuringiensis Transcripts that showed significantly increased expression in N2 animals infected by bacteria BMB171/Cry5Ba, an acrystalliferous Bt mutant BMB171 transformed with toxin gene cry5Ba on the shuttle vector pHT304, comparing to N2 animals infected by BMB171/pHT304. N.A. WBPaper00064229:B.thuringiensis-Cry5Ba_upregulated
  Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2. DESeq2, fold change > 2, p-value < 0.01. WBPaper00061203:sin-3(tm1276)_upregulated
  Transcripts that showed significantly increased expression at the intestine cells of daf-2(e1370) comparing to the intestine cells of N2 animals at L2 larva stage. DESeq2 (version 1.24.0), fold change >= 2, FDR < 0.05 WBPaper00064632:daf-2(e1370)_upregulated_intestine
  Genes that showed significantly increased expression in daf-2(e1370);hel-1(gk148684) comparing to in hel-1(gk148684) To identify DEGs, Students t test and the log2 median ratio test were performed to compute t values and median ratios for all the annotated genes. The adjusted P values from each test were computed using an empirical distribution of the null hypothesis, which was obtained from random permutations of the samples. Finally, the adjusted P values from the individual tests were combined to compute the overall P values using Stouffers method , and genes with overall P < 0.05 and fold change > 1.5 were selected as DEGs. WBPaper00047131:daf-2(e1370)_upregulated_hel-1(gk148684)-background
  Genes that showed significantly increased expression in daf-2(e1370) comparing to in N2. To identify DEGs, Students t test and the log2 median ratio test were performed to compute t values and median ratios for all the annotated genes. The adjusted P values from each test were computed using an empirical distribution of the null hypothesis, which was obtained from random permutations of the samples. Finally, the adjusted P values from the individual tests were combined to compute the overall P values using Stouffers method , and genes with overall P < 0.05 and fold change > 1.5 were selected as DEGs. WBPaper00047131:daf-2(e1370)_upregulated_N2-background
  Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage. DESeq2 version 1.22.2, p < 0.05 WBPaper00064716:paraquat_downregulated
  Transcripts that showed significantly changed expression in 6-day post-L4 adult hermaphrodite comparing to in 1-day post L4 adult hermaphrodite animals. Sleuth WBPaper00051558:aging_regulated
  Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage. DESeq WBPaper00053302:stavudine_24h_regulated
  Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult. DESeq2, fold change > 2, adjusted p-value < 0.01 WBPaper00058598:sin-3(tm1276)_downregulated
  Transcripts depleted in purified oocyte P bodies comparing to in the whole animal. DESeq2, FDR < 0.05, fold change > 2. WBPaper00065975:P-body_vs_WholeAnimal_depleted
  Transcripts that showed significantly increased expression in wdr-5(ok1417);skn-1(lax188) comparing to in skn-1(lax188) at day 2 adult stage. fold change > 2 WBPaper00058711:wdr-5(ok1417)_upregulated
  Transcripts that showed significantly decreased expression in npr-8(ok1439) animals with 24 hour exposure to P. aeruginosa PA14, comparing to N2 animals with 24 hour exposure to P. aeruginosa PA14. DESeq2, fold change > 1.5, FDR < 0.05. WBPaper00058948:npr-8(ok1439)_downregulated_PA14
Reduced humidity (98% relative humidity). Genes that were down-regulated after one day exposure to reduced humidity (98% relative humidity) according to microarray analysis. Multiple hypothesis testing with the Benjamini-Hochberg correction was applied on calculated p-values. A change in the expression level was considered to be significant if the adjusted p-value was less than 0.001. WBPaper00044578:reduced-humidity_downregulated_microarray
  Genes that showed oscillating mRNA expression level throughout the 16 hour time courses from L3 larva to young adult. The following three lines of R code were used to perform the classification: increasing <-2*amplitude-PC1 < -1.7; oscillating <-!increasing & (amplitude > 0.55); flat <-!increasing & !oscillating; Note that the amplitude of a sinusoidal wave corresponds to only half the fold change between trough and peak. WBPaper00044736:oscillating_dev_expression
  Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:hypodermis_L3-L4-larva_expressed

6 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
    Expr1030669 Tiling arrays expression graphs  
Strain: BC12601 [F44B9.1a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GGGTGCAAGGGCTAGGTT] 3' and primer B 5' [GAGGATTTGGAGCTGAAAAATAAA] 3'. Expr6067 Adult Expression: pharynx; intestine - . cells; Larval Expression: pharynx;  
    Expr1151103 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  
    Expr1021402 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
    Expr2011044 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr2029281 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  

8 GO Annotation

Annotation Extension Qualifier
  located_in
  involved_in
  located_in
  enables
  involved_in
  enables
  enables
  enables

0 Homologues

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00001059 8038241 8041329 1

8 Ontology Annotations

Annotation Extension Qualifier
  located_in
  involved_in
  located_in
  enables
  involved_in
  enables
  enables
  enables

0 Regulates Expr Cluster

1 Sequence

Length
3089

1 Sequence Ontology Term

Identifier Name Description
gene  

1 Strains

WormBase ID
WBStrain00002222

1 Upstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrIII_8033635..8038240   4606 III: 8033635-8038240 Caenorhabditis elegans