WormMine: Gene WBGene00001096

• WormBase Gene ID: WBGene00001096
• Gene Name: dsc-1
• Sequence Name: C18B12.3
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable DNA-binding transcription factor activity, RNA polymerase II-specific and RNA polymerase II transcription regulatory region sequence-specific DNA binding activity. Involved in positive regulation of defecation rhythm and regulation of DNA-templated transcription. Located in cell projection; cytoplasm; and nucleus. Expressed in amphid neurons; enteric muscle; and mechanosensory neurons. Human ortholog(s) of this gene implicated in several diseases, including frontonasal dysplasia 1; frontonasal dysplasia 2; and gastrointestinal system cancer (multiple). Is an ortholog of human ALX1 (ALX homeobox 1); ALX3 (ALX homeobox 3); and ALX4 (ALX homeobox 4).
• Biotype: SO:0001217
• Genetic Position: X :21.8041 ±0.026154
• Length (nt): 3653

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00001096

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:C18B12.3.1	C18B12.3.1	1319	X: 15031180-15034832
Transcript:C18B12.3.2	C18B12.3.2	1232	X: 15031180-15034556

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:C18B12.3	C18B12.3	933	X: 15031464-15031538

5 RNAi Result

• WBRNAi00040899
• WBRNAi00010976
• WBRNAi00063861
• WBRNAi00029053
• WBRNAi00107288

56 Allele

• gk964260
• gk964029
• gk962707
• gk964028
• gk963810
• gk963581
• WBVar01928747
• qm133
• WBVar00243303
• gk302445
• gk302446
• gk302448
• gk302447
• gk302450
• gk302449
• gk302451
• tm241
• WBVar01760542
• WBVar01760543
• WBVar01760544
• WBVar02088463
• WBVar01622367
• WBVar01622368
• WBVar02083500
• WBVar01528244
• WBVar02027740
• WBVar00085971
• WBVar00085973
• WBVar00085972
• WBVar00085975

1 Chromosome

• WormBase ID: X
• Organism: Caenorhabditis elegans
• Length (nt): 17718942

1 Chromosome Location

• Feature . Primary Identifier: WBGene00001096
• Start: 15031180
• End: 15034832
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

0 Downstream Intergenic Region

64 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology.	DESEQ2, fold change > 2 and FDR < 0.01.	WBPaper00062103:neuron_enriched
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:bodywall-muscle_L1-larva_expressed
	Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin-Allantoin_upregulated
	Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin_upregulated
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:coelomocytes_L2-larva_expressed
	Transcripts that showed significantly increased expression in ilc-17.1(syb5296) comparing to in N2 animals at L4 larva stage.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00066594:ilc-17.1(syb5296)_upregulated
	Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals.	DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2.	WBPaper00062159:hda-2(ok1479)_upregulated
	Transcripts that showed significantly decreased expression in adbp-1(qj1) comparing to in N2 animals at L4 larva stage.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00067079:adbp-1(qj1)_downregulated_L4
	Transcripts that showed significantly decreased expression in set-2(tm1630) animals at embryo stage, comparing to in N2 animals.	DESeq2 (v2.1.8.3) was used to determine DE genes and to generate principal component and scatter plots. DE genes with FDR < 0.05 were analysed using g:Profiler with Bonferroni correction.	WBPaper00060014:set-2(tm1630)_downregulated
	Transcripts of coding genes that showed significantly increased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_enriched_coding-RNA
	Genes expressed in N2.	Expressed transcripts were identified on the basis of a Present call in 3 out of 4 N2 experiments as determined by Affymetrix MAS 5.0.	WBPaper00025141:N2_Expressed_Genes
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:A-class-motor-neurons_L1-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:bodywall-muscle_L2-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:GABAergic-motor-neurons_L1-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:intestine_L1-larva_expressed
	Transcripts that showed significantly increased expression in daf-2(e1370) neurons comparing to in N2 neurons at day 8adult stage.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00066978:daf-2(e1370)_upregulated_neuron
	Transcripts that showed significantly increased expression in daf-16(mu86);daf-2(e1370) neurons comparing to in daf-2(e1370) neurons at day 8adult stage.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00066978:daf-16(mu86)_upregulated_neuron
	Genes with differential expression under 1.0mg/l Diazinon treatment at 16 centigrade.	To identify the differentially expressed genes in each treatment authors used linear models per toxicant and temperature (gene expression = Toxicant (effect) + error). The lm function in R stats package was used to implement the linear models analysis with recommended default options. For threshold determination authors used a permutation approach. For each of the 23,232 permutations used authors randomly picked a transcript (array spot), which could only be picked once. Authors combined all the expression values of this transcript and randomly distributed them over the replicates and used them in the linear model. In this way authors obtained a threshold for each of the toxicants. Authors used a -log10 p-value 2 as common threshold for the analysis, which resembles to the following FDR per toxicant: 0.0155 for CPF at 24 centigrade, 0.0148 for DZN at 24 centigrade, 0.0168 for CPF+DZN at 24 centigrade, 0.0142 for CPF at 16 centigrade, 0.0151 for DZN at 16 centigrade, and 0.0148 for CPF+DZN, at 16 centigrade.	WBPaper00037113:Diazinon_16C_regulated
	Transcripts that showed significantly increased expression in unc-30(ok613) animals at L4 larva stage after 4 hours of Pseudomonas aeruginosa infection, comparing to infected N2 animals.	Genes exhibiting at least two-fold change were considered differentially expressed.	WBPaper00061439:unc-30(ok613)_upregulated_P.aeruginosa-infection
Bacteria infection: Photorhabdus luminescens	Genes with increased expression after 24 hours of infection by P.lumniescens Fold changes shown are pathogen vs OP50.	For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated.	WBPaper00038438:P.lumniescens_24hr_upregulated_TilingArray
	Transcripts that showed altered expression in cat-2(RNAi) animals comparing to control animals injected with empty vector.	p-value <= 0.05	WBPaper00066902:cat-2(RNAi)_regulated
	Transcripts that interact with 3xFLAG-DLC-1 as identified by immunoprecipitation followed by RNA sequencing.	DESeq2, fold change > 2,, p-value < 0.01	WBPaper00055334:DLC-1_interacting
	Transcripts that showed significantly decreased expression in mter-4(syb3662 syb3403) comparing to in N2.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00061995:mter-4(syb3662syb3403)_downregulated
25C vs. 20C	Transcripts that showed significantly decreased expression in 1-day post L4 adult hermaphrodite N2 grown at 25C, comparing to in N2 animals grown at 20C.	CuffDiff, fold change > 2.	WBPaper00065096:25C_vs_20C_downregulated
	Larval Pan-neural Enriched Genes.	A two-class unpaired analysis of the data was performed to identify genes that differ by >= 1.5-fold from the reference at a FDR of <1% for the larval pan-neural, embryonic pan-neural, and larval A-class motor neuron datasets.	WBPaper00030839:Larval_Pan_Neuronal
Fungi infection: Drechmeria coniospora	Genes with decreased expression after 12 hours of infection by D.coniospora Fold changes shown are pathogen vs OP50.	For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated.	WBPaper00038438:D.coniospora_12hr_downregulated_RNAseq
	Transcripts that showed significantly increased expression in hlh-26(ok1453) animals exposed to E. faecium for 8 hours, comparing to N2 animals exposed to E. faecium for 8 hours.	Fold change > 2.	WBPaper00062585:hlh-26(ok1453)_upregulated_E.faecium
	Transcripts that showed significantly increased expression in eat-2(ad1116) comparing to in N2 at 3-days post L4 adult hermaphrodite animals.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:eat-2(ad1116)_upregulated

10 Expression Patterns

• Primary Identifier: Expr5300
• Remark: Strain: BC10044
• Reporter Gene: [C18B12.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCCTCCTGTACACTCCGGT] 3' and primer B 5' [TGGTATGAGGGTTGATATTTGG] 3'.
• Pattern: Larval Expression: intestine; Nervous System; head neurons

• Primary Identifier: Expr7439
• Remark: Clone: pUL#JRH/AF7
• Pattern: Expression is seen in 2 head nerves, probably amphids, late embryo to adult, plus 3 further head nerves, although more weakly.

• Primary Identifier: Expr3760
• Pattern: Both the transcriptional and translational fusions are expressed in a subset of bilateral sensory neurons. These neurons are AWA, AWB, AWC, ASE, FLP and PVD. GFP expression could also occasionally be observed in a sixth pair of unidentified neurons, located to the anterior of AWC. In addition to expression in neurons, expression in the enteric muscles was also observed. Expression of the transcriptional fusion could be observed only in the sphincter muscle, whereas expression of the translational fusion was observed in the nuclei of the two intestinal muscles (IM) and the anal depressor muscle (AD), but not in the sphincter.
• Subcellular Localization: Expression of the transcriptional fusion was observed in both the cell bodies and axons, and in the cytoplasm as well as in the nucleus, whereas expression of the translational fusion was mostly confined to the nucleus.

• Primary Identifier: Expr10698

• Primary Identifier: Expr15617

• Primary Identifier: Expr2011101
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1018754
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr1170002
• Pattern: Time-lapse fluorescence microscopy was performed, including DIC for morphology. Gene expression patterns were summarized in 4 manners: Average over time, Average over time and at different positions along the anterior-posterior (AP) axis, a voxelized representation over time, and on individual cells overlaid from a reference coordinate dataset (https://doi.org/10.1016/j.ydbio.2009.06.014). The analysis was done with a pipeline based on the multi-purpose image analysis software Endrov (https://doi.org/10.1038/nmeth.2478), which further is needed to browse the raw recording data. Thumbnail movies were also generated, using maximum Z projection for the 3D fluorescence channel. Raw recordings available in the Endrov OST-file format are available at https://www.ebi.ac.uk/biostudies/studies/S-BIAD191?query=S-BIAD191

• Primary Identifier: Expr2029337
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1144946
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

17 GO Annotation

39 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00001096
• Start: 15031180
• End: 15034832
• Strand: -1

17 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 3653

1 Sequence Ontology Term

• Name: gene

3 Strains

• WBStrain00026677
• WBStrain00026682
• WBStrain00001137

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrX_15034833..15036709
• Length (nt): 1877
• Chromosome Location: X: 15034833-15036709
• Organism: Caenorhabditis elegans