WormMine: Gene WBGene00001135

• WormBase Gene ID: WBGene00001135
• Gene Name: eat-4
• Sequence Name: ZK512.6
• Brief Description: eat-4 encodes an ortholog of the mammalian BNPI vesicular glutamate transporter that affects chemotaxis, feeding, foraging and thermotaxis; eat-4 is expressed in specific neurons, including M3L and M3R which are known to be glutamatergic.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable L-glutamate transmembrane transporter activity; glutamate:sodium symporter activity; and neurotransmitter transmembrane transporter activity. Involved in several processes, including glutamatergic synaptic transmission; positive regulation of backward locomotion; and regulation of male mating behavior. Predicted to be located in excitatory synapse and synaptic vesicle membrane. Expressed in intestine; neurons; and pharynx. Human ortholog(s) of this gene implicated in autosomal dominant nonsyndromic deafness 25. Is an ortholog of human SLC17A7 (solute carrier family 17 member 7) and SLC17A8 (solute carrier family 17 member 8).
• Biotype: SO:0001217
• Genetic Position: III :0.173199 ±0.007369
• Length (nt): 4941

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00001135

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:ZK512.6a.1	ZK512.6a.1	2218	III: 9136887-9141827
Transcript:ZK512.6b.1	ZK512.6b.1	1668	III: 9137128-9141369

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:ZK512.6b	ZK512.6b	1668	III: 9137128-9137177
CDS:ZK512.6a	ZK512.6a	1731	III: 9136916-9136977

16 RNAi Result

• WBRNAi00089863
• WBRNAi00007255
• WBRNAi00059477
• WBRNAi00059478
• WBRNAi00059476
• WBRNAi00022040
• WBRNAi00022041
• WBRNAi00006036
• WBRNAi00006358
• WBRNAi00007183
• WBRNAi00027838
• WBRNAi00114355
• WBRNAi00089977
• WBRNAi00090136
• WBRNAi00090295
• WBRNAi00114346

70 Allele

• gk964518
• gk963887
• WBVar00070273
• WBVar00070278
• WBVar00070283
• gk717905
• gk612410
• gk413348
• gk835045
• gk910116
• gk801418
• gk493137
• gk661799
• gk579991
• gk688501
• gk510212
• gk686701
• gk818073
• gk797580
• gk685128
• gk692985
• gk797579
• gk610306
• gk662738
• gk660942
• gk326743
• gk708827
• gk785348
• gk437043
• gk685563

1 Chromosome

• WormBase ID: III
• Organism: Caenorhabditis elegans
• Length (nt): 13783801

1 Chromosome Location

• Feature . Primary Identifier: WBGene00001135
• Start: 9136887
• End: 9141827
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

0 Downstream Intergenic Region

185 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:all-neurons_L1-larva_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood.	SAM	WBPaper00031040:TGF-beta_adult_upregulated
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:AVE-neuron_L1-larva_expressed
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology.	DESEQ2, fold change > 2 and FDR < 0.01.	WBPaper00062103:neuron_enriched
	Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals.	Fold change > 2, FDR < 0.01.	WBPaper00065993:glp-1(e2141)_upregulated
	Transcripts that showed significantly increased expression after animals were treated with 100uM Psora and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Psora-Allantoin_upregulated
	Transcripts that showed significantly increased expression after animals were treated with 100uM Rapamycin and 50mM Metformin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Metformin_upregulated
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
	Genes that showed significantly increased expression in daf-2(e1370);hel-1(gk148684) comparing to in hel-1(gk148684)	To identify DEGs, Students t test and the log2 median ratio test were performed to compute t values and median ratios for all the annotated genes. The adjusted P values from each test were computed using an empirical distribution of the null hypothesis, which was obtained from random permutations of the samples. Finally, the adjusted P values from the individual tests were combined to compute the overall P values using Stouffers method , and genes with overall P < 0.05 and fold change > 1.5 were selected as DEGs.	WBPaper00047131:daf-2(e1370)_upregulated_hel-1(gk148684)-background
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:A-class-motor-neurons_L2-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:all-neurons_L2-larva_expressed
	Transcripts that showed significantly increased expression in hda-1(ne4752[3xFLAG-Degron-HDA-1]) in gonads dissected from 1-day old adult animals.	Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R.	WBPaper00061479:hda-1(ne4752)_upregulated
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:glr-1(+)-neurons_L2-larva_expressed
	Transcripts that showed significantly increased expression in wdr-23(mac32) embryos from parents fed with E. coliHB101, comparing to N2 embryos parents fed with E. coli HB101.	DESeq2, Fold Change > 2 or < 0.5.	WBPaper00059566:wdr-23(mac32)_upregulated
	Transcripts that showed significantly increased expression in ilc-17.1(syb5296) comparing to in N2 animals at L4 larva stage.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00066594:ilc-17.1(syb5296)_upregulated
	Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals.	DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2.	WBPaper00062159:hda-2(ok1479)_upregulated
	Transcripts that showed significantly decreased expression in eat-2(ad1116) comparing to in N2 at 3-days post L4 adult hermaphrodite animals.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:eat-2(ad1116)_downregulated
	Transcripts that showed significantly decreased expression in set-2(tm1630) animals at embryo stage, comparing to in N2 animals.	DESeq2 (v2.1.8.3) was used to determine DE genes and to generate principal component and scatter plots. DE genes with FDR < 0.05 were analysed using g:Profiler with Bonferroni correction.	WBPaper00060014:set-2(tm1630)_downregulated
	Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(+), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage.	DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2.	WBPaper00050859:upregulated_P-granule(-)GFP(+)_vs_control_day2-adult
	Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(-), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage.	DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2.	WBPaper00050859:upregulated_P-granule(-)GFP(-)_vs_control_day2-adult
	Genes found to be regulated by low-copy overexpression of sir-2.1 with p < 0.014.	N.A.	WBPaper00026929:sir-2.1_overexpression_regulated
	Genes expressed in N2.	Expressed transcripts were identified on the basis of a Present call in 3 out of 4 N2 experiments as determined by Affymetrix MAS 5.0.	WBPaper00025141:N2_Expressed_Genes
	Transcripts that showed significantly increased expression in animals fed with JM103 bacteria producing Cry5B, comparing to control animals fed with JM103.	ANOVA, p-value < 0.05.	WBPaper00056167:Cry5B_upregulated
24 hours of AgNPs exposure.	Genes downregulated more than 2 fold after 24 hours of AgNPs exposure.	Statistical differences between the control and exposed worms were determined by a parametric t test, and a Pearson correlation test was performed for correlation analysis, using the Statistical Package for the Social Sciences (SPSS, Chicago, IL).	WBPaper00034661:AgNPs_downregulated
	Transcripts that showed significantly increased expression in emb-4(hc60) comparing to in N2.	DESeq2	WBPaper00052884:emb-4(hc60)_upregulated

20 Expression Patterns

• Primary Identifier: Expr1162898
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr11375
• Pattern: eat-4 is expressed in 78 of the 302 neurons of the adult hermaphrodite, which fall into 38 neuron classes (out of a total of 118 anatomically defined neuron classes in the hermaphrodite). Most of these neurons are either sensory- or interneurons. Only two motorneurons utilize glutamate; both are located in the pharynx.

• Primary Identifier: Expr7220
• Remark: Strain: BC13603
• Reporter Gene: [eat-4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GATTTATGAGTTGGAAAGGTCTGG] 3' and primer B 5' [GATGGTTTCTGAAAATGATGATGA] 3'.
• Pattern: Adult Expression: intestine; Nervous System; nerve ring; head neurons; neurons along body; tail neurons; Larval Expression: intestine; Nervous System; nerve ring; head neurons; neurons along body; tail neurons

• Primary Identifier: Expr1261
• Pattern: Expressed in a subset of neurons in the pharynx and in the extrapharyngeal nervous system. Expression was also noticed in intestine cells(int1-int9). In the pharynx, eat-4 was found to be expressed in M3, NSM neurons, and possibly I5, but not in muscle. Clear and consistent eat-4 reporter expression was found in 15 different anatomical types. ADA, ALM, ASH, ASK, AUA, and AVJ or AIN, AVM, FLP, IL1, LUA, OLL, OLQ, PLM, PVD, and PVR.

• Primary Identifier: Expr15340
• Remark: Promoter 6-1

• Primary Identifier: Expr15341
• Remark: Promoter 6

• Primary Identifier: Expr9198
• Pattern: Consistent expression of EAT-4::GFP was observed in many head neurons including AFD, AWC, AIZ, and RIA, which are constituents of the thermotaxis neural circuit.

• Primary Identifier: Expr15337
• Remark: Promoter 1

• Primary Identifier: Expr15338
• Remark: Promoter 2

• Primary Identifier: Expr15339
• Remark: Promoter 5

• Primary Identifier: Expr2011158
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr16459

• Primary Identifier: Expr13303
• Pattern: Peat-4::eat-4::mCherry is expressed in I4 and I6 in only 10% (for I4) and 60% (for I6) of the wild-type animals examined.

• Primary Identifier: Expr12429
• Pattern: Expression was observed in I2, but not in the NSM neuron.

• Primary Identifier: Expr12032
• Pattern: PVV (P11.paaa) was identified as the only neuron expressing eat-4::GFP beginning in the late L4 stage and continuing throughout adulthood, based on both its position and cell-killing experiments.

• Primary Identifier: Chronogram1149
• Remark: Original chronogram file: chronogram.2272.xml
• Reporter Gene: [ZK512.6:gfp] transcriptional fusion.

• Primary Identifier: Expr1029221
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr12905
• Subcellular Localization: EAT-4 is localized stringently to the distal axonal segment.

• Primary Identifier: Expr2029394
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1200374
• Pattern: Data from the TransgeneOme project

33 GO Annotation

14 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00001135
• Start: 9136887
• End: 9141827
• Strand: 1

33 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 4941

1 Sequence Ontology Term

• Name: gene

13 Strains

• WBStrain00022005
• WBStrain00022006
• WBStrain00027259
• WBStrain00027260
• WBStrain00031071
• WBStrain00032439
• WBStrain00055124
• WBStrain00005551
• WBStrain00005552
• WBStrain00005282
• WBStrain00005518
• WBStrain00005553
• WBStrain00005482

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrIII_9134020..9136886
• Length (nt): 2867
• Chromosome Location: III: 9134020-9136886
• Organism: Caenorhabditis elegans