WormMine: Gene WBGene00001840

• WormBase Gene ID: WBGene00001840
• Gene Name: hel-1
• Sequence Name: C26D10.2
• Brief Description: hel-1 encodes an ortholog of human 56-kD U2AF65 associated protein (UAP56)that is required for exporting mRNAs from the nucleus; unlike animals withRNAi against several other splicing factors, hel-1(RNAi) animals fail toexport transgenic GFP mRNA from the nucleus; conversely, hel-1overexpression is lethal, with failed transgene expression as well.
• Organism: Caenorhabditis elegans
• Automated Description: Enables RNA polymerase II-specific DNA-binding transcription factor binding activity. Involved in determination of adult lifespan; nuclear mRNA surveillance; and positive regulation of gene expression. Located in nucleus. Part of transcription regulator complex. Expressed in hypodermis; intestine; and neurons. Human ortholog(s) of this gene implicated in type 1 diabetes mellitus. Is an ortholog of human DDX39A (DExD-box helicase 39A).
• Biotype: SO:0001217
• Genetic Position: II :0.761021 ±0.000763
• Length (nt): 2019

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00001840

Genomics

2 Transcripts

Class	WormMine ID	Sequence Name	Length (nt)	Chromosome Location
MRNA	Transcript:C26D10.2a.1	C26D10.2a.1	1522	II: 8326852-8328870
NcPrimaryTranscript	Transcript:C26D10.2b	C26D10.2b	1594	II: 8327095-8328869

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:C26D10.2a	C26D10.2a	1278	II: 8327095-8327114

38 RNAi Result

• WBRNAi00008167
• WBRNAi00041258
• WBRNAi00075483
• WBRNAi00075484
• WBRNAi00085353
• WBRNAi00094024
• WBRNAi00008438
• WBRNAi00064862
• WBRNAi00091015
• WBRNAi00102175
• WBRNAi00029225
• WBRNAi00075218
• WBRNAi00075219
• WBRNAi00024637
• WBRNAi00108877
• WBRNAi00108932
• WBRNAi00108987
• WBRNAi00107265
• WBRNAi00107229
• WBRNAi00107213
• WBRNAi00107201
• WBRNAi00107179
• WBRNAi00107186
• WBRNAi00107167
• WBRNAi00107129
• WBRNAi00107078
• WBRNAi00107402
• WBRNAi00107387
• WBRNAi00107373
• WBRNAi00107358

30 Allele

• gk963801
• gk963053
• gk962682
• gk963446
• WBVar01695795
• WBVar01376223
• ok3698
• gk148680
• gk828859
• gk148679
• gk393614
• gk148682
• gk191
• gk602750
• gk148681
• gk148678
• gk816791
• gk482400
• gk785229
• gk390134
• gk148684
• gk552655
• gk148683
• gk1424
• gk354808
• gk378257
• gk148685
• WBVar02089227
• gk941963
• gk941964

1 Chromosome

• WormBase ID: II
• Organism: Caenorhabditis elegans
• Length (nt): 15279421

1 Chromosome Location

• Feature . Primary Identifier: WBGene00001840
• Start: 8326852
• End: 8328870
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

0 Downstream Intergenic Region

158 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	oocyte proteins identified by two or more unique peptides during proteomics study.	In the pooled data set, 1453 C. elegans proteins were identified with a probability >= 0.9 according to ProteinProphet, of which 1165 proteins were identified by more than one unique peptide.	WBPaper00038289:oocyte_protein
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
	Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin-Allantoin_upregulated
	Transcripts that showed significantly increased expression after animals were treated with 100uM Psora and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Psora-Allantoin_upregulated
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Genes significantly enriched in NSM neurons (isolated by FACS) versus the reference, according to RNAseq analysis towards total RNA.	Gene expression quantification and differential expression was analyzed using cufflinks v2.2.1. Enriched contains only genes significantly enriched (differentially expressed >= 2.4 fold in total RNA or >= 3.2 fold in DSN treated total RNA) in the NSM neurons versus the reference.	WBPaper00045974:NSM_enriched_totalRNA_RNAseq
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_daf-16(mu86);glp-1(e2141)
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141)
	Transcripts expressed in vulva.	FPKM >= 1.	WBPaper00064122:vulva_transcriptome
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M
	Transcripts that showed significantly changed expression in 6-day post-L4 adult hermaphrodite comparing to in 1-day post L4 adult hermaphrodite animals.	Sleuth	WBPaper00051558:aging_regulated
	Transcripts depleted in purified oocyte P bodies comparing to in whole oocytes.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_oocyte_depleted
	Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy.	Cufflinks	WBPaper00065120:body-muscle-transcriptome
Temprature shift to 28C for 24 hours.	Transcripts that showed significantly decreased expression after animals were exposed to 28C temperature for 24 hours.	Differentially expressed genes wereidentified using DESeq (v.1.18.0) by normalizing readsbased on the negative binomial distribution method andcomparing each HS timepoint to the 0-h control.	WBPaper00061341:28C_24h_downregulated
	Transcripts that showed significantly increased expression in ilc-17.1(syb5296) comparing to in N2 animals at L4 larva stage.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00066594:ilc-17.1(syb5296)_upregulated
	Transcripts detected in germline isolated from day-1 adult hermaphrodite animals.	All three experiments have CPM >= 1.	WBPaper00067147:germline_expressed
	Proteins interacting with HA-PPM-1.D.	N.A.	WBPaper00062498:PPM-1.D_interacting
	Genes that were not enriched in either spermatogenic fem-3(q96gf) nor oogenic fog-2(q71) gonads, according to RNAseq analysis.	To identify differentially expressed transcripts, authors used R/Bioconductor package DESeq.	WBPaper00045521:Gender_Neutral
	Transcripts that showed significantly decreased expression in the neurons of bcat-1(RNAi) animals at 5-days post L4 adult hermaphrodite stage, comparing to animals injected with empty vector.	DESeq2. FDR < 0.05.	WBPaper00060459:bcat-1(RNAi)_downregulated

9 Expression Patterns

• Primary Identifier: Expr5341
• Remark: Strain: BC12615
• Reporter Gene: [hel-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGCTGAGCATGCTTCTTATAACTC] 3' and primer B 5' [GTTGTTCCTCTTCGATTCTGAAA] 3'.
• Pattern: Adult Expression: pharynx; anal depressor muscle; Reproductive System; vulval muscle; spermatheca; body wall muscle; unidentified cells; Larval Expression: pharynx; anal depressor muscle; body wall muscle; unidentified cells

• Primary Identifier: Expr5342
• Remark: Also expressed in (comments from author) : Possibly nerve ring expression. Strain: BC10898
• Reporter Gene: [hel-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGCTGAGCATGCTTCTTATAACTC] 3' and primer B 5' [GTTGTTCCTCTTCGATTCTGAAA] 3'.
• Pattern: Adult Expression: pharynx; Reproductive System; vulval muscle; body wall muscle; Nervous System; ventral nerve cord; head neurons; tail neurons; unidentified cells; Larval Expression: pharynx; body wall muscle; Nervous System; ventral nerve cord; head neurons; tail neurons; unidentified cells

• Primary Identifier: Expr1031084
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr12409
• Pattern: HEL-1::GFP localizes to the nuclei of cells in various tissues, including neurons, hypodermis, and intestine, throughout development.

• Primary Identifier: Expr1026321
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr2030631
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr2012395
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Chronogram952
• Remark: Original chronogram file: chronogram.2.xml
• Reporter Gene: [C26D10.2:gfp] transcriptional fusion.

• Primary Identifier: Expr1145299
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

25 GO Annotation

10 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00001840
• Start: 8326852
• End: 8328870
• Strand: -1

25 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 2019

1 Sequence Ontology Term

• Name: gene

4 Strains

• WBStrain00035692
• WBStrain00037647
• WBStrain00002229
• WBStrain00001557

0 Upstream Intergenic Region