WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00001716 Gene Name  grl-7
Sequence Name  ? T02E9.2 Brief Description  grl-7 encodes a hedgehog-like protein, with an N-terminal signalsequence, a central low-complexity region, and a C-terminal Ground-like(Grl) domain; GRL-7 is expressed in intestine, hypodermis, and seamcells; the Grl domain is predicted to form a cysteine-crosslinkedprotein involved in intercellular signalling, and it has subtlesimilarity to the N-terminal Hedge domain of HEDGEHOG proteins.
Organism  Caenorhabditis elegans Automated Description  Located in apical plasma membrane. Expressed in hypodermal cell and ventral cord blast cell.
Biotype  SO:0001217 Genetic Position  V :3.07557 ±0.000511
Length (nt)  ? 2185
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00001716

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:T02E9.2b.1 T02E9.2b.1 1131   V: 11344828-11347012
Transcript:T02E9.2a.1 T02E9.2a.1 1185   V: 11344831-11347012
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:T02E9.2a T02E9.2a 1059   V: 11344956-11345031
CDS:T02E9.2b T02E9.2b 1002   V: 11344956-11345031

3 RNAi Result

WormBase ID
WBRNAi00052216
WBRNAi00018027
WBRNAi00035063

32 Allele

Public Name
gk963271
gk963301
gk964451
gk964452
WBVar02061029
tm12960
gk390346
gk585768
gk896260
gk478607
gk414949
gk334352
gk865009
gk600796
gk851174
gk784889
WBVar01865736
WBVar01865735
WBVar01865737
WBVar02024353
WBVar01461758
WBVar00004225
WBVar01274904
gk954457
gk247263
gk247261
gk960292
gk247262
gk948959
WBVar01743487

1 Chromosome

WormBase ID Organism Length (nt)
V Caenorhabditis elegans 20924180  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00001716 11344828 11347012 -1

3 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  

1 Downstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrV_11344726..11344827   102 V: 11344726-11344827 Caenorhabditis elegans

335 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Genes with expression altered >= 3-fold in dpy-10(e128) mutants. Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)). WBPaper00035873:dpy-10_regulated
  Transcripts that showed significantly increased expression in ogt-1(ok1474) neuronal cells isolated by FACs comparing to in FACs isolated neuronal cells from wild type. DESeq2, fold change > 2, FDR < 0.05. WBPaper00066485:ogt-1(ok1474)_upregulated_neuron
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
  TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood. SAM WBPaper00031040:TGF-beta_adult_upregulated
Osmotic stress Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present DESeq(version 1.10.1), FDR < 0.05. WBPaper00050726:OsmoticStress_regulated_Food
Osmotic stress Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when no food was present DESeq(version 1.10.1), FDR < 0.05. WBPaper00050726:OsmoticStress_regulated_NoFood
Bacteria infection: Enterococcus faecalis Genes with increased expression after 24 hours of infection by E.faecalis Fold changes shown are pathogen vs OP50. For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated. WBPaper00038438:E.faecalis_24hr_upregulated_TilingArray
Fungi infection: Myzocytiopsis humicola Transcripts that showed significantly altered expression 12 hours after animals were infected by M. humicola. Differentially expressed genes as determined by Kallisto and Sleuth (pval<0.01, qval<0.1). WBPaper00060871:M.humicola-infection_12h_regulated
  Proteins interacting with NHR-49-GFP according to co-IP and LC-MS. N.A. WBPaper00064071:NHR-49_interacting
  Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:arcade_intestinal-valve_expressed
  Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:hypodermis_expressed
  Genes up regulated in alg-1(gk214) comparing to in N2. Differential expression was assessed using an empirical Bayes statistics using the eBayes function. WBPaper00040823:alg-1(gk214)_upregulated
  Genes with expression level regulated by genotype (N2 vs CB4856) and age at L3 larva and Late reproduction stage (96 hours at 24 centigrade). For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR). WBPaper00040858:eQTL_age_regulated_developing
  Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals. Fold change > 2, FDR < 0.05 WBPaper00064088:Day-3-adult_vs_L4_downregulated_daf-16(mu86);glp-1(e2141)
  Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals. Fold change > 2, FDR < 0.05 WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141)
Bacteria infection: Bacillus thuringiensis Transcripts that showed significantly increased expression in N2 animals infected by bacteria BMB171/Cry5Ba, an acrystalliferous Bt mutant BMB171 transformed with toxin gene cry5Ba on the shuttle vector pHT304, comparing to N2 animals infected by BMB171/pHT304. N.A. WBPaper00064229:B.thuringiensis-Cry5Ba_upregulated
  Transcripts that showed significantly increased expression after four-day-old young adult worms were placed on NGM plates seeded with OP50 in the presence 5% Agaro-oligosaccharides(AGO) for 24 h, comparing to animals grown in the absence of AGO. Fold change > 2. WBPaper00064306:Agaro-oligosaccharides_upregulated
  Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2. DESeq2, fold change > 2, p-value < 0.01. WBPaper00061203:sin-3(tm1276)_upregulated
  Transcripts that showed significantly increased expression in daf-2(e1370) comparing to in control animals. NOIseq(v2.34.0), fold change > = 1.5, Differentially expressed genes (DEGs) were defined as having a probability of differentialexpression > 95%. WBPaper00064727:daf-2(e1370)_upregulated
  Transcripts that showed signifcantly increased expression in ubr-5(miy31) injected with empty vector comparing to in N2 animals injected with empty vector at L1 larva stage and collected at L4 larva stage. FDR < 0.05, fold change > 2 WBPaper00067368:ubr-5(miy31)_upregulated_N2
Bacteria infection: Staphylococcus aureus Transcripts that showed significantly decreased expression in animals experimentally colonised by a wild microbiota community and infected by the widespread animal pathogen, Staphylococcus aureus, comparing to animals not colonized by microbiota and not infected by pathogen. DeSeq2 (v. 1.42.0), Wald analyses testing against a null hypothesis of < |1.5|-fold change in gene expression between treatments (BenjaminiHochberg adjusted false detection rate of p <= 0.05. WBPaper00067479:Microbiota-Pathogen_vs_control_downregulated
Bacteria infection: Staphylococcus aureus Transcripts that showed significantly decreased expression in animals experimentally colonised by a wild microbiota community and infected by the widespread animal pathogen, Staphylococcus aureus, comparing to animals not colonized by microbiota but infected by pathogen. DeSeq2 (v. 1.42.0), Wald analyses testing against a null hypothesis of < |1.5|-fold change in gene expression between treatments (BenjaminiHochberg adjusted false detection rate of p <= 0.05. WBPaper00067479:Microbiota-Pathogen_vs_Pathogen_downregulated
  Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage. DESeq WBPaper00053302:stavudine_24h_regulated
  Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult. DESeq2, fold change > 2, adjusted p-value < 0.01 WBPaper00058598:sin-3(tm1276)_downregulated
  Transcripts that showed significantly decreased exression in animals exposed to 100uM cadmium for 24 hours. DESeq2 v1.20.0, fold change > 2, FDR < 0.05. WBPaper00065029:cadmium_downregulated
  Transcripts depleted in purified oocyte P bodies comparing to in the whole animal. DESeq2, FDR < 0.05, fold change > 2. WBPaper00065975:P-body_vs_WholeAnimal_depleted
  Transcripts that showed significantly decreased expression in 10-days post L4 adult hermaphrodite npr-8(ok1439) animals grown at 20C, comparing to in N2 animals. CuffDiff, fold change > 2. WBPaper00065096:npr-8(ok1439)_downregulated_Day10_20C
  Genes that showed increased expression after nicotic acid (NA) treatment. Raw counts for the genes were analyzed using the R Statistical Computing Environment and the Bioconductor packages DESeq and edgeR. Both packages provide statistical routines for determining differential expression in digital gene expression data using a model based on the negative binomial distribution. The resulting p-values were adjusted using the Benjamini and Hochberg's approach for controlling the false discovery rate (FDR). If both FDR values (by DESeq and edgeR) were smaller than p = 0.05, genes were assigned as differentially expressed. WBPaper00044260:nicotinc-acid_upregulated
  Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy. Cufflinks WBPaper00065120:body-muscle-transcriptome
  Transcripts that showed significantly decreased expression in npr-8(ok1439) animals with 24 hour exposure to P. aeruginosa PA14, comparing to N2 animals with 24 hour exposure to P. aeruginosa PA14. DESeq2, fold change > 1.5, FDR < 0.05. WBPaper00058948:npr-8(ok1439)_downregulated_PA14

9 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
    Expr4447 Expressed in the hypodermis, from embryo stage through adulthood. Expressed in the seam cells from L3 through adult.  
    Expr1031027 Tiling arrays expression graphs  
Also expressed in (comments from author) : No comments. Strain: BC15289 [grl-7::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CGTCTGTTCTTTGTACGGGAG] 3' and primer B 5' [CGGAATAGGATTCTGGAAATAGAA] 3'. Expr6573 Adult Expression: intestine; hypodermis; seam cells; Larval Expression: intestine; hypodermis; seam cells;  
    Expr16250 PTR-18 and GRL-7 are temporally localized along the periphery of the apical membranes of hypodermal and P neuronal progenitor cells during late embryogenesis and are subsequently targeted to lysosomal degradation before hatching. Similar to PTR-18::GFP, GRL-7::mCherry::3xFLAG was first detected in the 3-fold embryos GRL-7::mCherry::3xFLAG localized along the apical side of the surface cells that cover the whole body as well as in the intracellular structures of these cells. As observed for PTR-18::GFP, the majority of the GRL-7::mCherry::3xFLAG embryos initially showed an apical distribution. However, as the embryos neared hatching, internal, vesicular localization became predominant. GRL-7::mCherry exhibits striped patterns of localization, which likely shows annular furrows.  
    Expr15721 Expression of both grl-5 and grl-7 gfp-pest reporter genes was readily detected in the hypodermis and P cells after hatching. In addition, these reporters sporadically show expression in seam cells.  
    Expr2030508 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr2012272 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr1155848 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  
    Expr1012644 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

1 GO Annotation

Annotation Extension Qualifier
  located_in

0 Homologues

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00001716 11344828 11347012 -1

1 Ontology Annotations

Annotation Extension Qualifier
  located_in

0 Regulates Expr Cluster

1 Sequence

Length
2185

1 Sequence Ontology Term

Identifier Name Description
gene  

1 Strains

WormBase ID
WBStrain00032683

1 Upstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrV_11347013..11347112   100 V: 11347013-11347112 Caenorhabditis elegans