WormMine: Gene WBGene00001786

• WormBase Gene ID: WBGene00001786
• Gene Name: gst-38
• Sequence Name: F35E8.8
• Brief Description: gst-38 encodes a glutathione-S-transferase; gst-38 is predicted to function as a phase II detoxification enzyme and its expression is altered in response to stress; a GST-38::GFP reporter is expressed in the intestine.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable glutathione transferase activity. Involved in PERK-mediated unfolded protein response and innate immune response. Is an ortholog of human HPGDS (hematopoietic prostaglandin D synthase).
• Biotype: SO:0001217
• Genetic Position: V :9.13328 ±0.002914
• Length (nt): 909

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00001786

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:F35E8.8.1	F35E8.8.1	852	V: 15915162-15916070

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:F35E8.8	F35E8.8	630	V: 15915250-15915740

11 RNAi Result

• WBRNAi00046363
• WBRNAi00014346
• WBRNAi00031791
• WBRNAi00070155
• WBRNAi00069812
• WBRNAi00095417
• WBRNAi00095430
• WBRNAi00103332
• WBRNAi00069839
• WBRNAi00115484
• WBRNAi00115547

66 Allele

• gk963271
• gk964458
• gk964459
• WBVar02124626
• WBVar02124261
• WBVar02122682
• WBVar02124830
• WBVar02121287
• WBVar02124905
• WBVar02123702
• WBVar02121632
• WBVar01800637
• WBVar02091030
• WBVar02091029
• ttTi9388
• ttTi9392
• WBVar01591596
• WBVar01591595
• WBVar01591594
• WBVar01591604
• WBVar01591603
• WBVar01591602
• WBVar01591601
• WBVar01591600
• WBVar01591599
• WBVar01591598
• WBVar01591597
• WBVar00026820
• WBVar00026825
• gk615806

1 Chromosome

• WormBase ID: V
• Organism: Caenorhabditis elegans
• Length (nt): 20924180

1 Chromosome Location

• Feature . Primary Identifier: WBGene00001786
• Start: 15915162
• End: 15916070
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrV_15915143..15915161
• Length (nt): 19
• Chromosome Location: V: 15915143-15915161
• Organism: Caenorhabditis elegans

351 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Genes with expression altered >= 3-fold in dpy-10(e128) mutants.	Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)).	WBPaper00035873:dpy-10_regulated
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Genes that were upregulated in lin-15B(n744).	For each gene in each microarray hybridization experiment, the ratio of RNA levels from the two samples was transformed into a log2 value and the mean log2 ratio was calculated. The log2 ratios were normalized by print-tip Loess normalization (Dudoit and Yang, 2002). All genes with a false discovery rate of <= 5% (q <= 0.05) (Storey and Tibshirani, 2003) and a mean fold-change ratio of >= 1.5 were selected for further analysis.	WBPaper00038168:lin-15B(n744)_upregulated
Bacteria infection: Enterococcus faecalis	Genes with increased expression after 24 hours of infection by E.faecalis Fold changes shown are pathogen vs OP50.	For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated.	WBPaper00038438:E.faecalis_24hr_upregulated_TilingArray
	Transcripts that showed significantly increased expression in hsf-1(sy441) vs. in N2 day 1 adults without heat shock.	edgeR, fold change > 2, FDR < 0.05	WBPaper00066900:hsf-1(sy441)_upregulated
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Genes that are significantly up regulated in tdp-1(ok803) poly(A) RNA-seq verses in N2.	DESeq v1.14, with cut-off p-value < 0.05 and FDR < 0.1.	WBPaper00046012:tdp-1(ok803)_upregulated
	Transcripts that showed significantly decreased expression in atfs-1(cmh15) (null allele) animals comparing to in N2 animals at L4 larva stage.	edgeR, fold change > 2, FDR < 0.05	WBPaper00060909:atfs-1(cmh15)_downregulated
	Genes up regulated in alg-1(gk214) comparing to in N2.	Differential expression was assessed using an empirical Bayes statistics using the eBayes function.	WBPaper00040823:alg-1(gk214)_upregulated
	Genes with expression level regulated by genotype (N2 vs CB4856) at L3 larva and Late reproduction stage (96 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_regulated_developing
	Transcripts that showed significantly increased expression in whole animal day 1 N2 adults comparing to in whole animal day 8 N2 adults.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00066978:Day1Adult_vs_Day8Adult_upregulated_neuron
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_daf-16(mu86);glp-1(e2141)
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141)
	Transcripts that showed significantly decreased expression in adbp-1(qj1) comparing to in N2 animals at L4 larva stage.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00067079:adbp-1(qj1)_downregulated_L4
	Transcripts that showed significantly increased expression in mrg-1(qa6200) comparing to in control animals in primordial germ cells (PGCs) at L1 larva stage.	DESeq2(v1.32.0), FDR < 0.05.	WBPaper00064315:mrg-1(qa6200)_upregulated_PGCs
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
	Transcripts that showed significantly increased expression in nhr-114(gk849) comparing to wild type animals at L4 larva.	DESeq2 1.26.0, fold change > 2, FDR < 0.05.	WBPaper00064539:nhr-114(gk849)_upregulated
	Transcripts that showed signifcantly increased expression in pabp-2(RNAi) animals comparing to in N2 animals injected with empty vector at L1 larva stage and collected at L4 larva stage.	FDR < 0.05, fold change > 2	WBPaper00067368:pabp-2(RNAi)_upregulated_N2
Bacteria infection: Staphylococcus aureus	Transcripts that showed significantly decreased expression in animals experimentally colonised by a wild microbiota community and infected by the widespread animal pathogen, Staphylococcus aureus, comparing to animals colonized by microbiota but not infected by pathogen.	DeSeq2 (v. 1.42.0), Wald analyses testing against a null hypothesis of < |1.5|-fold change in gene expression between treatments (BenjaminiHochberg adjusted false detection rate of p <= 0.05.	WBPaper00067479:Microbiota-Pathogen_vs_Microbiota_downregulated
	Transcripts that showed significantly decreased expression in N2 day 4 adults comparing to in N2 day 1 adult animals according to Illumina RNASeq.	DESeq fold change > 2, FDR < 0.05.	WBPaper00067499:Day4_vs_Day1_downregulated_Illumina
	Transcripts that showed significantly decreased expression in N2 day 5 adults comparing to in N2 day 1 adult animals according to Illumina RNASeq.	DESeq fold change > 2, FDR < 0.05.	WBPaper00067499:Day5_vs_Day1_downregulated_Illumina
	Transcripts that showed significantly decreased expression in N2 day 5 adults comparing to in N2 day 1 adult animals according to Oxford Nanopore Technologies Direct RNA sequencing (Nanopore DRS).	DESeq fold change > 2, FDR < 0.05.	WBPaper00067499:Day5_vs_Day1_downregulated_Nanopore
	Transcripts that showed significantly decreased expression in N2 day 7 adults comparing to in N2 day 1 adult animals according to Illumina RNASeq.	DESeq fold change > 2, FDR < 0.05.	WBPaper00067499:Day7_vs_Day1_downregulated_Illumina
	Transcripts that showed significantly decreased expression in N2 day 7 adults comparing to in N2 day 1 adult animals according to Oxford Nanopore Technologies Direct RNA sequencing (Nanopore DRS).	DESeq fold change > 2, FDR < 0.05.	WBPaper00067499:Day7_vs_Day1_downregulated_Nanopore
	Transcripts that showed significantly decreased expression in N2 day 10 adults comparing to in N2 day 1 adult animals according to Illumina RNASeq.	DESeq fold change > 2, FDR < 0.05.	WBPaper00067499:Day10_vs_Day1_downregulated_Illumina
	Transcripts that showed significantly decreased expression in N2 day 10 adults comparing to in N2 day 1 adult animals according to Oxford Nanopore Technologies Direct RNA sequencing (Nanopore DRS).	DESeq fold change > 2, FDR < 0.05.	WBPaper00067499:Day10_vs_Day1_downregulated_Nanopore
	Transcripts that showed significantly decreased expression in N2 day 15 adults comparing to in N2 day 1 adult animals according to Illumina RNASeq.	DESeq fold change > 2, FDR < 0.05.	WBPaper00067499:Day15_vs_Day1_downregulated_Illumina
	Transcripts that showed significantly decreased expression in N2 day 15 adults comparing to in N2 day 1 adult animals according to Oxford Nanopore Technologies Direct RNA sequencing (Nanopore DRS).	DESeq fold change > 2, FDR < 0.05.	WBPaper00067499:Day15_vs_Day1_downregulated_Nanopore

7 Expression Patterns

• Primary Identifier: Expr1031052
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr5953
• Remark: Strain: BC14266
• Reporter Gene: [gst-38::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTGACCAACACGTGTGAATG] 3' and primer B 5' [AACCGTTGAGAATCTGAATTGAA] 3'.
• Pattern: Adult Expression: intestine; Nervous System; head neurons; amphids; tail neurons; phasmids; Larval Expression: intestine; Nervous System; head neurons; amphids; tail neurons; phasmids

• Primary Identifier: Expr8016
• Remark: Picture: Figure 2O, 20, 2P, 2p.
• Pattern: Expressed constitutively without acrylamide. Control animal without acrylamide. GFP signal was constitutively detected from the intestine region. Animal treated with 500 mg/l acrylamide. Stronger GFP signal detected from the intestine region.

• Primary Identifier: Expr1150245
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr1021623
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr2030557
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr2012321
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

6 GO Annotation

4 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00001786
• Start: 15915162
• End: 15916070
• Strand: -1

6 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 909

1 Sequence Ontology Term

• Name: gene

0 Strains

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrV_15916071..15916333
• Length (nt): 263
• Chromosome Location: V: 15916071-15916333
• Organism: Caenorhabditis elegans