WormMine: Gene WBGene00001898

• WormBase Gene ID: WBGene00001898
• Gene Name: his-24
• Sequence Name: M163.3
• Brief Description: his-24 encodes one of eight C. elegans H1 linker histones; HIS-24, along with the histone deacetylase SIR-2.1 and the Enhancer of zeste E(Z) ortholog MES-2, plays a key role in heterochromatin regulation and thus, in regulation of fertility and embryonic development; specifically, HIS-24 and SIR-2.1 are essential for maintenance of the histone H3K27me3 mark at subtelomeric regions in the C. elegans germ line; HIS-24 interacts specifically with the H3 K27 region, either when unmodified or when in the trimethylated (me3) state; HIS-24 is ubiquitously expressed and localizes to nuclei; in addition, in germ cells, the majority of HIS-24 localizes to the cytoplasm, in a manner dependent upon SIR-2.1 and MES proteins.
• Organism: Caenorhabditis elegans
• Automated Description: Enables H3K27me3 modified histone binding activity. Involved in chromatin remodeling; defense response to Gram-positive bacterium; and negative regulation of gene expression. Located in chromosome, telomeric region; cytoplasm; and nucleus. Expressed in several structures, including germ line and gonad. Is an ortholog of human H1-0 (H1.0 linker histone) and H1-8 (H1.8 linker histone).
• Biotype: SO:0001217
• Genetic Position: X :16.7093 ±0.005353
• Length (nt): 1026

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00001898

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:M163.3.1	M163.3.1	923	X: 14490094-14491119

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:M163.3	M163.3	627	X: 14490139-14490375

10 RNAi Result

• WBRNAi00050989
• WBRNAi00076030
• WBRNAi00064599
• WBRNAi00017226
• WBRNAi00027719
• WBRNAi00076031
• WBRNAi00089608
• WBRNAi00089638
• WBRNAi00076026
• WBRNAi00090698

33 Allele

• gk964260
• gk964029
• gk962707
• gk964028
• gk963810
• gk963581
• gk963779
• gk963780
• gk884263
• gk623161
• gk301106
• gk301105
• tm13044
• tm1102
• gk301107
• tm10331
• WBVar00218467
• WBVar01622205
• gk301108
• ok1024
• gk732710
• gk316582
• gk431474
• gk764328
• gk752846
• gk651435
• gk938362
• gk667395
• gk721107
• gk837334

1 Chromosome

• WormBase ID: X
• Organism: Caenorhabditis elegans
• Length (nt): 17718942

1 Chromosome Location

• Feature . Primary Identifier: WBGene00001898
• Start: 14490094
• End: 14491119
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrX_14491120..14496084
• Length (nt): 4965
• Chromosome Location: X: 14491120-14496084
• Organism: Caenorhabditis elegans

403 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	oocyte proteins identified by two or more unique peptides during proteomics study.	In the pooled data set, 1453 C. elegans proteins were identified with a probability >= 0.9 according to ProteinProphet, of which 1165 proteins were identified by more than one unique peptide.	WBPaper00038289:oocyte_protein
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when no food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_NoFood
	Transcripts that showed significantly higher expression in somatic gonad precursor cells (SGP) vs. head mesodermal cells (hmc).	DESeq2, fold change >= 2, FDR <= 0.01.	WBPaper00056826:SGP_biased
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Genes significantly enriched in NSM neurons (isolated by FACS) versus the reference, according to RNAseq analysis towards total RNA.	Gene expression quantification and differential expression was analyzed using cufflinks v2.2.1. Enriched contains only genes significantly enriched (differentially expressed >= 2.4 fold in total RNA or >= 3.2 fold in DSN treated total RNA) in the NSM neurons versus the reference.	WBPaper00045974:NSM_enriched_totalRNA_RNAseq
	Transcripts that showed significantly decreased expression at 5-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites.	DESeq2, fold change > 2, FDR < 0.05	WBPaper00065835:Day5_vs_Day1_downregulated
	Transcripts that showed significantly decreased expression in atfs-1(cmh15) (null allele) animals comparing to in N2 animals at L4 larva stage.	edgeR, fold change > 2, FDR < 0.05	WBPaper00060909:atfs-1(cmh15)_downregulated
	Genes up regulated in alg-1(gk214) comparing to in N2.	Differential expression was assessed using an empirical Bayes statistics using the eBayes function.	WBPaper00040823:alg-1(gk214)_upregulated
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_daf-16(mu86);glp-1(e2141)
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141)
	Transcripts that showed significantly decreased expression in lipl-4 overexpression transgenic lines comparing to wild type control animals.	DESeq2 fold change > 2, FDR < 0.05.	WBPaper00064156:lipl-4(overexpress)_downregulated
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
	Transcripts that showed significantly increased expression in mrg-1(qa6200) comparing to in control animals in primordial germ cells (PGCs) at L1 larva stage.	DESeq2(v1.32.0), FDR < 0.05.	WBPaper00064315:mrg-1(qa6200)_upregulated_PGCs
	Transcripts that showed significantly increased expression in hrde-1(tm1200) animals, comparing to in N2, after growing at 25C for five generations (late generation).	CuffDiff2	WBPaper00051265:F4_hrde-1(tm1200)_upregulated
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
Bacteria infection: Staphylococcus aureus MW2. 4 hours of exposure.	Transcripts that showed significantly increased expression after N2 animals had 4 hours of infection by Staphylococcus aureus (MW2).	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:S.aureus-4h_upregulated_N2
	Top 300 transcripts enriched in ABalppppppa, ABpraaapppa according to single cell RNAseq.	Top 300 enriched transcripts were determined by log2.ratio of the tpm in the cell type vs the tpm in the other cells * the log2 of the cell.type tpm.	WBPaper00061340:ASE_parent
	Genes that showed significantly increased expression in daf-2(e1370);hel-1(gk148684) comparing to in hel-1(gk148684)	To identify DEGs, Students t test and the log2 median ratio test were performed to compute t values and median ratios for all the annotated genes. The adjusted P values from each test were computed using an empirical distribution of the null hypothesis, which was obtained from random permutations of the samples. Finally, the adjusted P values from the individual tests were combined to compute the overall P values using Stouffers method , and genes with overall P < 0.05 and fold change > 1.5 were selected as DEGs.	WBPaper00047131:daf-2(e1370)_upregulated_hel-1(gk148684)-background
	Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	DESeq2, fold change > 2, adjusted p-value < 0.01	WBPaper00058598:sin-3(tm1276)_downregulated
	Transcripts depleted in purified oocyte P bodies comparing to in the whole animal.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_WholeAnimal_depleted
	Transcripts that showed significantly increased expression after exposure to 75uM paraquat(PQ) from L1 to day 2 adult stage in skn-1(lax188) animals	fold change > 2	WBPaper00058711:paraquat_upregulated
25C vs. 20C	Transcripts that showed significantly increased expression in 1-day post L4 adult hermaphrodite N2 grown at 25C, comparing to in N2 animals grown at 20C.	CuffDiff, fold change > 2.	WBPaper00065096:25C_vs_20C_upregulated
	Transcripts that showed significantly increased expression in 10-days post L4 adult hermaphrodite N2 grown at 20C, comparing to in 1-day post L4 adult hermaphrodite N2 animals grown at 20C.	CuffDiff, fold change > 2.	WBPaper00065096:Day10_vs_Day1_upregulated
	Transcripts that showed significantly increased expression in wdr-5(ok1417);skn-1(lax188) comparing to in skn-1(lax188) at day 2 adult stage.	fold change > 2	WBPaper00058711:wdr-5(ok1417)_upregulated
	Transcripts that showed significantly decreased expression in 10-days post L4 adult hermaphrodite npr-8(ok1439) animals grown at 20C, comparing to in N2 animals.	CuffDiff, fold change > 2.	WBPaper00065096:npr-8(ok1439)_downregulated_Day10_20C

15 Expression Patterns

• Primary Identifier: Expr4649
• Remark: The HIS-24 staining results were reproduced with an anti-GFP antibody and an integrated his-24::gfp transgenic animal line.
• Subcellular Localization: Indirect immunofluorescence analysis of wild-type animals revealed the expression pattern and the subcellular localization of HIS-24. In most, if not all, somatic cells, HIS-24 is expressed and exclusively associated with chromatin. It is, however, absent from the primordial germ cells Z2 and Z3, which are born in the embryo and rest during the first larval stage (L1). Germ line HIS-24 expression starts in the late L3 stage concomitant with gonad development and continues during adulthood. The protein, however, does not translocate into the germ nuclei but is associated with specific cytoplasmic granular structures surrounding the nuclei. Costaining with P-granule-specific antibodies revealed that the structures containing the cytoplasmic HIS-24 protein are not the P-granules. Cytoplasmic HIS-24 is characteristic for most developmental stages of the germ line, it is found in the mitotic region of the gonad, in the transition zone, in the meiotic region, and during all stages of oogenesis. SYTO-RNA-select staining of hermaphrodite gonads identified the well-known RNA component of the P granules but showed no staining of the HIS-24-containing granular structures. Only during the late pachytene stage is a small fraction of HIS-24 associated with chromatin. In the male gonad the germ line expression level of HIS-24 is considerably lower than that in hermaphrodites, but the protein is accordingly localized in the cytoplasm.

• Primary Identifier: Expr1031112
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr6427
• Remark: Also expressed in (comments from author) : GFP intensity is brightest in embryos. Strain: BC11274
• Reporter Gene: [his-24::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTGTGTCTCCTGAACCTGAAAAT] 3' and primer B 5' [ACAGCGGAATCAGAGATCGT] 3'.
• Pattern: Adult Expression: pharynx; intestine; unidentified cells; Larval Expression: pharynx; intestine; unidentified cells

• Primary Identifier: Expr10735

• Primary Identifier: Expr8710
• Remark: Picture: Fig. 2A.
• Subcellular Localization: HIS-24 and SIR-2.1 Co-localize in the nuclei of soma and at the ends of chromosomes at the pachytene stage.

• Primary Identifier: Expr880
• Remark: H1.1 = M163.3 M163.3 = his-24 --WS59. Reporter gene fusion type not specified.
• Pattern: Nuclear GFP fluorescence was detected beginning with the eight cell stage of the embryo in all somatic nuclei. The P-cell of early embryos and the germ nuclei of most adults remained nonfluorescent. A fraction of hermaphrodite animals (four observations in 210 animals scored) showed a prominent GFP expression in undifferentiated germ nuclei and a shallow but clearly identifiable GFP expression in oocytes and sperm. The occasional germline expression is a persistent property of the H1.1::GFP array and not lost after multiple generations. A strong H1.1::GFP fluorescence signal could be detected in male sperm and spermatocytes in addition to fluorescence in all somatic nuclei. A considerably weaker signal was present in undifferentiated germ nuclei.
• Subcellular Localization: Nuclear

• Primary Identifier: Expr1200215
• Pattern: Data from the TransgeneOme project

• Primary Identifier: Expr881
• Remark: According to cgc5366, this antibody is not reactive with H1.X. M163.3, Y73B6BL.U, F22F1.1, C18G1.5, B0414.3, F59A7.4, C01B10.5 and C30G7.1 encodes H1.1-H1.6, H1.Q and H1.x. Sequence: C01B10.5 not available in WS59, but there are C01B10.5a, b and c. Sequence: Y73B6BL.U not available in WS42.
• Pattern: All nuclei of the soma of all life stages as well as all nuclei of the germline were detected. In the male gonad, the germline-nuclei of mitotic and of meiotic regions were reactive with the antibody, as were spermatids and mature spermatozoa.
• Subcellular Localization: nuclei

• Primary Identifier: Expr1154695
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Chronogram704
• Remark: Original chronogram file: chronogram.1734.xml
• Reporter Gene: [M163.3:gfp] transcriptional fusion.

• Primary Identifier: Expr1170028
• Pattern: Time-lapse fluorescence microscopy was performed, including DIC for morphology. Gene expression patterns were summarized in 4 manners: Average over time, Average over time and at different positions along the anterior-posterior (AP) axis, a voxelized representation over time, and on individual cells overlaid from a reference coordinate dataset (https://doi.org/10.1016/j.ydbio.2009.06.014). The analysis was done with a pipeline based on the multi-purpose image analysis software Endrov (https://doi.org/10.1038/nmeth.2478), which further is needed to browse the raw recording data. Thumbnail movies were also generated, using maximum Z projection for the 3D fluorescence channel. Raw recordings available in the Endrov OST-file format are available at https://www.ebi.ac.uk/biostudies/studies/S-BIAD191?query=S-BIAD191

• Primary Identifier: Expr1200368
• Pattern: Data from the TransgeneOme project

• Primary Identifier: Expr1017900
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr2030679
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr2012443
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

26 GO Annotation

5 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00001898
• Start: 14490094
• End: 14491119
• Strand: 1

26 Ontology Annotations

2 Regulates Expr Cluster

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Genes with decreased expression level for L4 stage larvae in hpl-2; hpl-1 and his-24 hpl-1; hpl-2 compared to wild type (FDR < 0.05).	The gene expression fold change was calculated from the duplicate microarray data. The fold change cut-off was 1.5 from 2 biological replicates (FDR < 0.05). Fold change shown here are hpl-1; hpl-2; his-24 vs WT.	WBPaper00041609:hpl-1_hpl-2_downregulated
	Genes with increased expression level for L4 stage larvae in hpl-2; hpl-1 and his-24 hpl-1; hpl-2 compared to wild type (FDR < 0.05).	The gene expression fold change was calculated from the duplicate microarray data. The fold change cut-off was 1.5 from 2 biological replicates (FDR < 0.05). Fold change shown here are hpl-1; hpl-2; his-24 vs WT.	WBPaper00041609:hpl-1_hpl-2_upregulated

1 Sequence

• Length: 1026

1 Sequence Ontology Term

• Name: gene

4 Strains

• WBStrain00031772
• WBStrain00034807
• WBStrain00034782
• WBStrain00006458

0 Upstream Intergenic Region