WormMine: Gene WBGene00001918

• WormBase Gene ID: WBGene00001918
• Gene Name: his-44
• Sequence Name: F08G2.1
• Brief Description: his-44 encodes an H2B histone.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable DNA binding activity and protein heterodimerization activity. Predicted to be a structural constituent of chromatin. Involved in innate immune response. Predicted to be part of nucleosome. Is an ortholog of several human genes including H2BC12 (H2B clustered histone 12); H2BC17 (H2B clustered histone 17); and H2BC3 (H2B clustered histone 3).
• Biotype: SO:0001217
• Genetic Position: II :20.3298±
• Length (nt): 369

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00001918

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:F08G2.1.1	F08G2.1.1	369	II: 13826730-13827098

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:F08G2.1	F08G2.1	369	II: 13826730-13827098

17 RNAi Result

• WBRNAi00095560
• WBRNAi00094012
• WBRNAi00094226
• WBRNAi00090827
• WBRNAi00082054
• WBRNAi00044043
• WBRNAi00044044
• WBRNAi00044045
• WBRNAi00082059
• WBRNAi00061070
• WBRNAi00061071
• WBRNAi00061072
• WBRNAi00061073
• WBRNAi00103655
• WBRNAi00025035
• WBRNAi00027052
• WBRNAi00027055

4 Allele

• gk963801
• gk963053
• gk962684
• gk962539

1 Chromosome

• WormBase ID: II
• Organism: Caenorhabditis elegans
• Length (nt): 15279421

1 Chromosome Location

• Feature . Primary Identifier: WBGene00001918
• Start: 13826730
• End: 13827098
• Strand: -1

3 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrII_13825844..13826729
• Length (nt): 886
• Chromosome Location: II: 13825844-13826729
• Organism: Caenorhabditis elegans

71 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	oocyte proteins identified by two or more unique peptides during proteomics study.	In the pooled data set, 1453 C. elegans proteins were identified with a probability >= 0.9 according to ProteinProphet, of which 1165 proteins were identified by more than one unique peptide.	WBPaper00038289:oocyte_protein
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	Transcripts that showed significantly increased expression in csr-1a(tor159) comparing to in N2 at 25C.	DESeq2, fold change > 2, p-value < 0.05.	WBPaper00061753:csr-1(tor159)_upregulated_25C
	Transcripts that showed significantly higher expression in somatic gonad precursor cells (SGP) vs. head mesodermal cells (hmc).	DESeq2, fold change >= 2, FDR <= 0.01.	WBPaper00056826:SGP_biased
	Transcripts that showed significantly decreased expression in daf-16(mgDf50) comparing to in N2 at L1 larva stage.	DESeq v1.20.0 was used to analyze differential gene expression. Transcripts with adjusted p-value < 0.05 were considered differentialled expressed.	WBPaper00048971:daf-16(mgDf50)_downregulated_L1
	Transcripts that showed significantly increased expression in hda-1[KKRR] in gonads dissected from 1-day old adult animals.	Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R.	WBPaper00061479:hda-1(ne4747)_upregulated
Bacteria infection: Staphylococcus aureus	mRNAs that showed increased expression 8 hours after N2 animals were infected by S. aureus.	DESeq, p <= 0.05	WBPaper00045314:S.aureus-induced_N2
	Transcripts that showed significantly increased expression in flr-1(RNAi) comparing to in control RNAi animals. This is an incomplete list.	N.A.	WBPaper00055060:flr-1(RNAi)_downregulated
	Transcriptions that showed significantly increased expression in skn-1(RNAi) comparing to empty vector injection into rrf-3(pk1426);daf-2(e1368) animals.	Genes with an absolute fold changeof at least 2 and standard p-values below 0.05 were considered as differentially expressed.	WBPaper00062193:skn-1(RNAi)_upregulated
	Transcripts that showed significantly increased expression in hira-1(gk835598) comparing to in N2 animals at L4 larva stage.	Differential expression analysis was done with Rversion 2.15.3 using DESeq_1.10.1. Fold change > 2, p-value < 0.01.	WBPaper00059739:hira-1(gk835598)_upregulated_L4
	Genes that were not enriched in either spermatogenic fem-3(q96gf) nor oogenic fog-2(q71) gonads, according to RNAseq analysis.	To identify differentially expressed transcripts, authors used R/Bioconductor package DESeq.	WBPaper00045521:Gender_Neutral
	Genes found to be regulated by low-copy overexpression of sir-2.1 with p < 0.014.	N.A.	WBPaper00026929:sir-2.1_overexpression_regulated
	Transcripts of coding genes that showed significantly increased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_enriched_coding-RNA
	Transcripts that showed significantly increased expression in him-17(me24) comparing to in N2 animals.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00064769:him-17(me24)_upregulated
	Transcripts that showed significantly increased expression in sams-3(RNAi) comparing to N2 animals injected with empty vector.	Deseq FDR < 0.01, fold change > 2.	WBPaper00065005:sams-3(RNAi)_upregulated
	Transcripts that showed significantly increased expression in sams-4(RNAi) comparing to N2 animals injected with empty vector.	Deseq FDR < 0.01, fold change > 2.	WBPaper00065005:sams-4(RNAi)_upregulated
	Transcripts that showed differential expression in dauer mir-34(gk437) vs dauer mir-34(OverExpression) animals at 20C.	N.A.	WBPaper00050488:mir-34(gk437)_vs_mir-34(OverExpression)_regulated_dauer_20C
	Differentially-expressed genes in the MA lines.		WBPaper00025099:MA_specific
	Transcripts that showed differential expression in dauer N2 vs dauer mir-34(gk437) animals at 20C.	N.A.	WBPaper00050488:N2_vs_mir-34(gk437)_regulated_dauer_20C
	Transcripts that showed significantly increased expression in pals-22(jy3) comparing to in N2 at L4 larva stage.	Differential expression analysis was performed in RStudio (v1.1.453) using R (v3.50) and Bioconductor (v3.7) packages. As outlined in the RNAseq123 vignette, data was imported, filtered and normalized using edgeR, and linear modeling and differential expression analysis was performed using limma. An FDR cutoff of <0.01 was used to define differentially expressed genes; no fold-change criteria was used.	WBPaper00056034:pals-22(jy3)_upregulated
	Transcripts that showed significantly increased expression in pals-22(jy3)pals-25(jy9) comparing to in pals-22(jy3) at L4 larva stage.	Differential expression analysis was performed in RStudio (v1.1.453) using R (v3.50) and Bioconductor (v3.7) packages. As outlined in the RNAseq123 vignette, data was imported, filtered and normalized using edgeR, and linear modeling and differential expression analysis was performed using limma. An FDR cutoff of <0.01 was used to define differentially expressed genes; no fold-change criteria was used.	WBPaper00056034:pals-25(jy9)_upregulated
	Transcripts that interact with 3xFLAG-DLC-1 as identified by immunoprecipitation followed by RNA sequencing.	DESeq2, fold change > 2,, p-value < 0.01	WBPaper00055334:DLC-1_interacting
Wounding: 2 hours after a single stab of a microinjection needle to either anterior or posterior body of lateral hyp7 (avoid the gonad) 24 hr after the L4 stage.	Transcripts that showed significantly increased expression 2 hours after animals had a single stab of a microinjection needle to either anterior or posterior body of lateral hyp7 (avoid the gonad) 24 hr after the L4 stage.	The cutoff for differential expressed genes (DEGs) were: Benjamini-Hochberg adjustedP-valueless than 0.05 and fold change larger than 1.5.	WBPaper00059987:Wounding_upregulated
	Transcripts that showed significantly increased expression in nhl-2(ok818) comparing to in N2 at 25C.	EdgeR, FDR < 0.05, fold change < 0.5.	WBPaper00055971:nhl-2(ok818)_25C_downregulated
	Transcripts that showed significantly decreased expression in lin-22(icb38) comparing to in N2 at L3 larva.	Differences in gene expression were then calculated using the negative binomial test in the DESeq package (FDR = 0.1).	WBPaper00053295:lin-22(icb38)_downregulated
	Transcripts that showed significantly decreased expression in flcn-1(ok975) comparing to in N2.	Student's t-test.	WBPaper00056471:flcn-1(ok975)_downregulated
	Transcripts that showed significantly increased expression in ogt-1(ok1474) comparing to in wild type.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00066485:ogt-1(ok1474)_upregulated_WholeAnimal
	Transcripts that showed significantly decreased expression in tmc-1(rg1003) comparing to in N2.	DESeq2. The genes with a fold change >= 2 and a false discovery rate (FDR) < 0.05 in a comparison were identified as significant DEGs.	WBPaper00065746:tmc-1(rg1003)_downregulated
Bacteria infection: Pseudomonas aeruginosa PA14. 4 hours at 25C.	Transcripts that showed significantly increased expression after N2 L4 animals were infected by P. aeruginosa (PA14) bacteria for 4 hours at 25C, comparing to N2 animals grown in OP50.	DESeq2	WBPaper00056275:P.aeruginosa_upregulated

4 Expression Patterns

• Primary Identifier: Expr5690
• Remark: Also expressed in (comments from author) : Note: primers are not unique and produce 2 products. Can predict correct product. Strain: BC12120
• Reporter Gene: [his-44::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GATCTCAAAATCTAACCGAACCC] 3' and primer B 5' [ATGTTGAGAGTTGGTGACTTGAAA] 3'.
• Pattern: Adult Expression: intestine; Larval Expression: intestine; hypodermis; seam cells

• Primary Identifier: Expr1148009
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr2030697
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1027242
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00001918
• Start: 13826730
• End: 13827098
• Strand: -1

5 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 369

1 Sequence Ontology Term

• Name: gene

0 Strains

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrII_13827099..13827325
• Length (nt): 227
• Chromosome Location: II: 13827099-13827325
• Organism: Caenorhabditis elegans