WormMine: Gene WBGene00002131

• WormBase Gene ID: WBGene00002131
• Gene Name: inx-9
• Sequence Name: ZK792.3
• Brief Description: inx-9 encodes an innexin, an integral transmembrane channel protein that is a structural component of invertebrate gap junctions; although the precise role of INX-9 in C. elegans development and/or behavior is not yet known, INX-9 may play a role in gonad or germline development, as INX-9 expression is detected solely in the sheath cells of the somatic gonad and particularly, the sheath cells in contact with proximal oocytes.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable gap junction channel activity. Acts upstream of or within with a positive effect on germ cell proliferation. Located in gap junction. Expressed in several structures, including gonad; interfacial epithelial cell; nerve ring neurons; pharyngeal cell; and spermatocyte.
• Biotype: SO:0001217
• Genetic Position: IV :5.17869 ±0.012345
• Length (nt): 2144

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00002131

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:ZK792.3.1	ZK792.3.1	1301	IV: 11676354-11678497

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:ZK792.3	ZK792.3	1149	IV: 11676384-11676520

13 RNAi Result

• WBRNAi00078643
• WBRNAi00066216
• WBRNAi00059716
• WBRNAi00085666
• WBRNAi00085667
• WBRNAi00027103
• WBRNAi00038438
• WBRNAi00066310
• WBRNAi00071911
• WBRNAi00071473
• WBRNAi00078545
• WBRNAi00066163
• WBRNAi00066284

37 Allele

• gk964278
• gk964078
• gk964500
• gk962765
• gk964319
• h15961
• gk720671
• gk620615
• gk565246
• gk829550
• gk791844
• gk512767
• gk568964
• gk732395
• gk570946
• WBVar01858323
• gk398338
• gk880554
• WBVar01858324
• gk364423
• WBVar00192143
• gk935626
• gk838285
• WBVar01688199
• gk479447
• gk633427
• gk594485
• gk472247
• gk388197
• qy79

1 Chromosome

• WormBase ID: IV
• Organism: Caenorhabditis elegans
• Length (nt): 17493829

1 Chromosome Location

• Feature . Primary Identifier: WBGene00002131
• Start: 11676354
• End: 11678497
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

0 Downstream Intergenic Region

122 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals.	Fold change > 2, FDR < 0.01.	WBPaper00065993:glp-1(e2141)_upregulated
	Genes that were upregulated in lin-15B(n744).	For each gene in each microarray hybridization experiment, the ratio of RNA levels from the two samples was transformed into a log2 value and the mean log2 ratio was calculated. The log2 ratios were normalized by print-tip Loess normalization (Dudoit and Yang, 2002). All genes with a false discovery rate of <= 5% (q <= 0.05) (Storey and Tibshirani, 2003) and a mean fold-change ratio of >= 1.5 were selected for further analysis.	WBPaper00038168:lin-15B(n744)_upregulated
	Transcripts that showed significantly higher expression in somatic gonad precursor cells (SGP) vs. head mesodermal cells (hmc).	DESeq2, fold change >= 2, FDR <= 0.01.	WBPaper00056826:SGP_biased
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-1-adult_vs_L4_upregulated_daf-16(mu86);glp-1(e2141)
	Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva fem-3(q20) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-1-adult_vs_L4_upregulated_fem-3(q20)
	Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-1-adult_vs_L4_upregulated_glp-1(e2141)
	Transcripts that showed significantly increased expression in day 3 adult hermaphrodite comparing to in L4 larva fem-3(q20) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_upregulated_fem-3(q20)
Dietary restriction	Transcripts that showed significantly decreased expression after N2 animals were under dietary restriction (DR, OP50 OD = 0.1) from 3-day post L4 till 6-day post L4 adult hermaphrodite stage, comparing to under ad libtum (AL, OP50 OD = 3) condition.	Bioconductor package edgeR, p < 0.05.	WBPaper00056443:DietaryRestriction_downregulated
	Transcripts that showed significantly increased expression in hrde-1(tm1200) animals, comparing to in N2, after growing at 25C for five generations (late generation).	CuffDiff2	WBPaper00051265:F4_hrde-1(tm1200)_upregulated
	Significantly upregulated genes from clk-1(qm30) microarrays using SAM algorithm with an FDR < 0.1 from adult-only chips.	SAM algorithm with an FDR < 0.1.	WBPaper00033065:clk-1(qm30)_upregulated
	Transcripts depleted in purified oocyte P bodies comparing to in whole oocytes.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_oocyte_depleted
	Transcripts depleted in purified oocyte P bodies comparing to in the whole animal.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_WholeAnimal_depleted
	Transcripts that showed significantly increased expression in 10-days post L4 adult hermaphrodite N2 grown at 20C, comparing to in 1-day post L4 adult hermaphrodite N2 animals grown at 20C.	CuffDiff, fold change > 2.	WBPaper00065096:Day10_vs_Day1_upregulated
	Proteins that showed significantly decreased expression in 1-day-old sek-1(km4) adults comparing to in wild type animals, both with 6 hours of cisplatin treatment.	The differential expression analysis was performed in R. Differentially expressed proteins were identified by using a two-sided t-test on log-transformed data.	WBPaper00065373:sek-1(km4)_downregulated_cisplatin
	Transcripts that showed significantly increased expression in clk-1(qm30) comparing to in N2.	Differential gene expression analysis was performed using the quasi-likeli-hood framework in edgeR package v. 3.20.1 in R v. 3.4.1.	WBPaper00053810:clk-1(qm30)_upregulated
	Transcripts that showed significantly increased expression in daf-2(e1370) comparing to in N2.	Differential gene expression analysis was performed using the quasi-likeli-hood framework in edgeR package v. 3.20.1 in R v. 3.4.1.	WBPaper00053810:daf-2(e1370)_upregulated
	Transcripts that showed significantly increased expression in nuo-6(qm200) comparing to in N2.	Differential gene expression analysis was performed using the quasi-likeli-hood framework in edgeR package v. 3.20.1 in R v. 3.4.1.	WBPaper00053810:nuo-6(qm200)_upregulated
	Transcripts that showed significantly increased expression in mbl-1(syb4318), referred to as mbl-1short(ex7-), comparing to in N2 at L4 larva stage.	DESeq2, Fold change > 2 and FDR < 0.05	WBPaper00066410:mbl-1(syb4318)_upregulated
	Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:dopaminergic-neurons_L3-L4-larva_expressed
	Transcripts that showed significantly altered expression at URX, AQR, and PQR neurons in camt-1(ok515) animals comparing to in wild type AX1888-1 strain.	RNA-seq data were mapped using PRAGUI - a Python 3-based pipeline for RNA-seq data analysis.	WBPaper00061902:camt-1(ok515)_regulated_URX-AQR-PQR
	Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:PVD-OLL-neurons_L3-L4-larva_expressed
	Transcripts that showed significantly increased expression in ilc-17.1(syb5296) comparing to in N2 animals at L4 larva stage.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00066594:ilc-17.1(syb5296)_upregulated
	Transcripts that showed significantly decreased expression in eat-2(ad1116) comparing to in N2 at 3-days post L4 adult hermaphrodite animals.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:eat-2(ad1116)_downregulated
	Transcripts that showed significantly decreased expression after animals were treated with 100uM Psora and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Psora-Allantoin_downregulated
	Transcripts that showed significantly decreased expression after animals were treated with 100uM Psora from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Psora_downregulated
	Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin and 50mM Metformin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Metformin_downregulated
	Transcripts detected in germline isolated from day-1 adult hermaphrodite animals.	All three experiments have CPM >= 1.	WBPaper00067147:germline_expressed

9 Expression Patterns

• Primary Identifier: Expr1163136
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr8677
• Remark: Picture: Fig 3.
• Pattern: Expression in the alimentary canal: Strong and consistent expression in anterior arcades, posterior arcades. Weak or rare expression in pm2, pm3, pm4, pm5, pm6, pm7, pm8, mc1, g1, g2, rectal gland cells, rectal epithelial cells. Expression in the nervous system: Phsh, AVK, DVC (early larva), PVR, SIB (early larva), URB, I3. Expression in the reproductive system: In adult stage, expressed in gonad sheath, uterus, vulval muscle. In developing larva stage, expressed in vulva. Neuronal expression of inx-9 appears around three-fold stage. The rectal gland expresses inx-9 during early larval stages. inx-9 is expressed in adult hermaphrodite sex muscles. inx-9 was expressed at high levels in arcade cells starting around two-fold stage continuing throughout development and adulthood.

• Primary Identifier: Expr7254
• Remark: Also expressed in (comments from author) : Unidentified cells in reproductive system.Embryo incomplete. To be updated. Strain: BC11010
• Reporter Gene: [inx-9::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTTTAATTTTGTAACGTTCGACCC] 3' and primer B 5' [CATTCTGTCCCTTTGAACCAA] 3'.
• Pattern: Adult Expression: intestine; unidentified cells in body ; Larval Expression: intestine; unidentified cells in body

• Primary Identifier: Expr1952
• Remark: Reporter gene fusion type not specified.
• Pattern: Sheath cell, esp. in contact with proximal oocyte.

• Primary Identifier: Expr11974
• Pattern: Expression of INX-8, -9, -14, -21 and -22 overlapped closely throughout the gonad in wild-type adult hermaphrodites. In distal arms clusters of fine puncta were associated with each germ cell, as previously reported for INX-14 and INX-22 expression (Govindan et al. 2009). INX-8/9 (antibodies raised against INX-8 shown to cross-react with INX-9) INX-8::GFP and INX-9::GFP were expressed in the distal tip cell (DTC) in addition to the somatic sheath. In the DTC, INX-8/9, INX-8::GFP and INX-9::GFP associated with long processes that extended from the DTC proximally, especially those running between germ cells and intercalating among them. At the distal limit of sheath cell coverage of germ cells, longer formations sometimes appeared associated with the apparent edge of the sheath cells. At the loop region of the gonad arm, individual puncta appeared in larger, higher-density aggregates. In the proximal arm puncta size was more variable, with many appearing to be considerably larger than the fine puncta seen in the distal arm. The expression levels of INX-8, INX-9 appeared higher in the proximal gonad. Throughout the gonad the localization patterns of INX-8::GFP and INX-9::GFP were indistinguishable. In addition to gonadal expression, antibody staining of whole mounts suggested that INX-8/9 may be expressed in some pharyngeal and a few other head neurons (T. Starich, unpublished results), but because the antibody reacted primarily with processes and not cell bodies we did not attempt to identify these neurons. Male gonads were examined and found to express INX-8, -9, -14, -21 and -22 as well. Presumptive gap junctions forming between both male distal tip cells and germ cells were detected with antibodies specific to INX-8/9, INX-14, INX-21, and INX-22. INX-8::GFP and INX-9::GFP were both expressed in the DTCs. No expression was detected in the transition zone, but innexin expression appeared to outline individual germ cells in the pachytene region. All 5 innexins are also expressed in the regions occupied by differentiated spermatocytes and sperm, with evidence of puncta formation. Expression of INX-9::GFP visualized somatic coverage of spermatids, probably by cells of the seminal vesicle, but somatic coverage of germ cells in the pachytene region of the male gonad has not been described. Examination of earlier developmental stages showed that all five innexins are expressed in the primordial gonad, consisting of somatic gonadal precursors Z1 and Z4 and the primordial germ cells Z2 and Z3. Early larval expression patterns differ from adults in that distinct, well-defined puncta potentially corresponding to gap junctions are less clearly discernible. In L2-L4 larval stages, germ cell innexins appear to be continually expressed, and somatic innexins are expressed predominantly in the DTC. In late L2 and early L3 stages, as the gonad arm lengthens, the migrating DTC seems to trail a process behind it that maintains contact with the germ cell compartment. The DTC appears to form gap junctions with germ cells at both long external processes and processes that intercalate between germ cells. At this time a second, more proximal focus of somatic innexin expression was sometimes detected. Though this second focus might represent extensions from the DTC, expression of inx-9::gfp suggested that other somatic cells besides the DTC might be involved. By the late L3 stage, the DTC no longer appears to be in contact with all of the germ cells. To better understand the contacts between germ cells and the DTC, we examined early L4-stage animals by TEM. We observed several processes trailing behind the DTC cell body on the outer edge of the germ line, as well as extensions that dig deeply between germ cells. The immunofluorescence results suggest that gap junctions form between the DTC and germ cells at both the outer and inner DTC arms. The inx-8 promoter was fused to mCherry, and inx-8p::mCherry was expressed during larval development in most or all of the somatic gonad cells derived from Z1 and Z4, including the DTC, sheath/spermathecal precursors and uterine cell precursors. We conclude that although expression of INX-8/9 appears to be strongest in the DTC during larval development, other somatic gonad cells may also express INX-8/9 at this time.

• Primary Identifier: Expr1022372
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr2012804
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr2031043
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Chronogram1760
• Remark: Original chronogram file: chronogram.676.xml
• Reporter Gene: [ZK792.3:gfp] transcriptional fusion.

12 GO Annotation

8 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00002131
• Start: 11676354
• End: 11678497
• Strand: 1

12 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 2144

1 Sequence Ontology Term

• Name: gene

4 Strains

• WBStrain00035924
• WBStrain00036232
• WBStrain00005698
• WBStrain00005325

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrIV_11675636..11676353
• Length (nt): 718
• Chromosome Location: IV: 11675636-11676353
• Organism: Caenorhabditis elegans