WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00002976 Gene Name  lev-9
Sequence Name  ? T07H6.5 Organism  Caenorhabditis elegans
Automated Description  Predicted to enable peptidase inhibitor activity. Located in extracellular space. Expressed in body wall musculature; cholinergic neurons; dorsal nerve cord; nerve ring; and ventral nerve cord. Human ortholog(s) of this gene implicated in several diseases, including Alzheimer's disease; IgA glomerulonephritis; autoimmune disease (multiple); and coronary artery disease (multiple). Is an ortholog of several human genes including C4BPA (complement component 4 binding protein alpha); CR1 (complement C3b/C4b receptor 1 (Knops blood group)); and CR1L (complement C3b/C4b receptor 1 like). Biotype  SO:0001217
Genetic Position  X :-3.1862 ±0.020335 Length (nt)  ? 9886
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00002976

Genomics

3 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:T07H6.5b.1 T07H6.5b.1 4186   X: 6281847-6291549
Transcript:T07H6.5c.1 T07H6.5c.1 1881   X: 6286129-6291527
Transcript:T07H6.5a.1 T07H6.5a.1 2165   X: 6286449-6291732
 

Other

3 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:T07H6.5a T07H6.5a 1869   X: 6286540-6286643
CDS:T07H6.5b T07H6.5b 4044   X: 6281967-6282169
CDS:T07H6.5c T07H6.5c 1881   X: 6286129-6286149

8 RNAi Result

WormBase ID
WBRNAi00052808
WBRNAi00052809
WBRNAi00018407
WBRNAi00018408
WBRNAi00035327
WBRNAi00065511
WBRNAi00112699
WBRNAi00065507

205 Allele

Public Name
gk964260
WBVar01926936
WBVar01926937
otn12632
WBVar01758614
WBVar01758613
WBVar01758616
WBVar01758615
WBVar01758618
WBVar01758617
WBVar01758619
WBVar01758621
WBVar01758620
otn11649
otn11651
otn11650
otn11653
otn11652
gk434283
gk411885
gk743765
gk850300
gk728732
gk869347
gk345823
gk905814
gk684972
gk631970
gk481256
gk574672

1 Chromosome

WormBase ID Organism Length (nt)
X Caenorhabditis elegans 17718942  

1 Chromosome Location


Feature . Primary Identifier 		Start End Strand
WBGene00002976 6281847 6291732 -1

4 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  
Panther orthologue and paralogue predictions  

1 Downstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrX_6280922..6281846   925 X: 6280922-6281846 Caenorhabditis elegans

108 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
Osmotic stress Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present DESeq(version 1.10.1), FDR < 0.05. WBPaper00050726:OsmoticStress_regulated_Food
  Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals. Fold change > 2, FDR < 0.01. WBPaper00065993:glp-1(e2141)_upregulated
  Transcripts that showed significantly decreased expression at 5-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites. DESeq2, fold change > 2, FDR < 0.05 WBPaper00065835:Day5_vs_Day1_downregulated
  Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:GABAergic-neuron_expressed
  Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2. DESeq2, fold change > 2, p-value < 0.01. WBPaper00061203:sin-3(tm1276)_upregulated
  Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage. DESeq2 version 1.22.2, p < 0.05 WBPaper00064716:paraquat_downregulated
  Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult. DESeq2, fold change > 2, adjusted p-value < 0.01 WBPaper00058598:sin-3(tm1276)_downregulated
  Transcripts depleted in purified oocyte P bodies comparing to in the whole animal. DESeq2, FDR < 0.05, fold change > 2. WBPaper00065975:P-body_vs_WholeAnimal_depleted
  Transcripts that showed significantly increased expression in hpk-1(pk1393) comparing to in N2 at adult day 2. DESeq 2, fold change > 2, FDR < 0.05. WBPaper00065581:hpk-1(pk1393)_upregulated
  Transcripts that showed significantly increased expression in hda-1(ne4752[3xFLAG-Degron-HDA-1]) in gonads dissected from 1-day old adult animals. Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R. WBPaper00061479:hda-1(ne4752)_upregulated
  Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals. DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2. WBPaper00062159:hda-2(ok1479)_upregulated
  Transcripts that showed significantly increased expression in npr-15(tm12539) comparing to in N2 at L4 larva stage. Fold change > 2, FDR < 0.05. WBPaper00066608:npr-15(tm12539)_upregulated
  Transcripts that showed significantly increased expression in srbc-48(ac23);kyIs262;fer-1(b232ts) comparing to in kyIs262;fer-1(b232ts), 24h after infection with P.aeruginosa. DESeq2, FDR <0.05, fold change > 2. WBPaper00059664:srbc-48(ac23)_upregulated
  Transcripts that showed significantly decreased expression after animals were treated with 100uM Psora and 250uM Allantoin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Psora-Allantoin_downregulated
  Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin and 250uM Allantoin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Rapamycin-Allantoin_downregulated
  Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin and 50mM Metformin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Rapamycin-Metformin_downregulated
  Transcripts that showed significantly decreased expression after animals were treated with 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Rifampicin-Allantoin_downregulated
  Transcripts that showed significantly decreased expression after animals were treated with 50uM Rifampicin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Rifampicin_downregulated
  Transcripts that showed significantly decreased expression in set-2(tm1630) animals at embryo stage, comparing to in N2 animals. DESeq2 (v2.1.8.3) was used to determine DE genes and to generate principal component and scatter plots. DE genes with FDR < 0.05 were analysed using g:Profiler with Bonferroni correction. WBPaper00060014:set-2(tm1630)_downregulated
  Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(+), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage. DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2. WBPaper00050859:upregulated_P-granule(-)GFP(+)_vs_control_day2-adult
  Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(-), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage. DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2. WBPaper00050859:upregulated_P-granule(-)GFP(-)_vs_control_day2-adult
  Genes significantely Up-regulated by GRO-seq in csr-1 hypomorph vs. N2 using DESeq p < 0.05. DESeq package with an FDR of < 0.05. WBPaper00045050:csr-1(hypomorph)_upregulated
  Transcripts of coding genes that showed significantly increased expression in muscle. DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed. WBPaper00062325:muscle_enriched_coding-RNA
20C vs 25C Transcripts that showed differential expression in 20C vs 25C in mir-34(OverExpression) animals at adult stage. N.A. WBPaper00050488:20C_vs_25C_regulated_mir-34(OverExpression)_adult
Bacteria infection: Serratia marcescens Genes with increased expression after 24 hours of infection by S.marcescens Fold changes shown are pathogen vs OP50. For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated. WBPaper00038438:S.marcescens_24hr_upregulated_TilingArray
  Genes expressed in N2. Expressed transcripts were identified on the basis of a Present call in 3 out of 4 N2 experiments as determined by Affymetrix MAS 5.0. WBPaper00025141:N2_Expressed_Genes
  Genes that showed significantly decreased expression in wrn-1(gk99) comparing to in N2, according to RNAseq. DESeq was used to calculate the fold changes, log fold changes, and significance of the changes for each comparison. WBPaper00045934:wrn-1(gk99)_downregulated
  WT-Pico Pan-neural Depleted Genes, with genes found multiple times in a single dataset removed (without dups). To identify differentially expressed transcripts, normalized intensity values from the pan-neural data sets were compared to a reference (from all larval cells) using Significance Analysis of Microarray software (SAM). A two class unpaired analysis of the data was performed to identify neuron-enriched genes. Pan-neural enriched transcripts in the IVT and WT-Pico-derived data set were defined as 1.5X elevated vs the reference at a False Discovery Rate (FDR) = 3%. WBPaper00031532:Larva_Pan_Neuronal_Depleted
  Transcripts that showed significantly increased expression in spr-1(ok2144) comparing to in N2. DESeq2, fold change > 2, p-value < 0.01. WBPaper00061203:spr-1(ok2144)_upregulated

11 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
    Expr1031376 Tiling arrays expression graphs  
Also expressed in (comments from author) : Embryo incomplete. To be updated. Strain: BC10343 [T07H6.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CAATCTTCGTCTGCTATACAC] 3' and primer B 5' [CCCGTGACGATTATCGATTT] 3'. Expr6634 Adult Expression: intestine - . cells; Nervous System; tail neurons; unidentified cells; Larval Expression: Nervous System; tail neurons; unidentified cells;  
No GO_term assigned. Picture: Fig. S5.   Expr8804   Fluorescence was detected in the pseudocoelomic cavity and in coelomocytes, six scavenger cells that filter the pseudocoelomic fluid. Therefore, LEV-9 is effectively secreted from body-wall muscle cells.
Picture: Fig 1c, 1d.   Expr8803 Transgenic lev-9 mutants expressed GFP solely in body wall muscle cells and were rescued for levamisole sensitivity.  
Picture: Fig 2, Fig S7.   Expr8805   LEV-9 is a protein secreted by muscle cells, which localizes at cholinergic neuromuscular junctions, most probably in the synaptic cleft. lev-9::T7 animals display a similar sensitivity to levamisole as wild-type animals. Immunofluorescence staining using anti-T7 antibodies specifically detected T7LEV-9 as puncta distributed along the ventral and dorsal nerve cords and in the nerve ring where head muscles are innervated. These puncta were juxtaposed to cholinergic varicosities and co-localized with L-AChR clusters.
    Expr1156410 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  
    Expr1156411 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  
    Expr2013087 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr1016513 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
    Expr2031319 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr1015366 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

7 GO Annotation

Annotation Extension Qualifier
  located_in
  located_in
  enables
  located_in
  located_in
  located_in
  located_in

1 Homologues

Type
least diverged orthologue

1 Locations


Feature . Primary Identifier 		Start End Strand
WBGene00002976 6281847 6291732 -1

7 Ontology Annotations

Annotation Extension Qualifier
  located_in
  located_in
  enables
  located_in
  located_in
  located_in
  located_in

0 Regulates Expr Cluster

1 Sequence

Length
9886

1 Sequence Ontology Term

Identifier Name Description
gene  

3 Strains

WormBase ID
WBStrain00032409
WBStrain00040921
WBStrain00001291

1 Upstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrX_6291733..6292277   545 X: 6291733-6292277 Caenorhabditis elegans