WormMine: Gene WBGene00003017

• WormBase Gene ID: WBGene00003017
• Gene Name: lin-31
• Sequence Name: K10G6.1
• Brief Description: lin-31 encodes a winged helix (WH)-like transcription factor that is a member of the HNF3/Forkhead family of DNA-binding proteins; LIN-31 acts as a tissue-specific effector of MAP kinase-mediated signaling in the vulva; when MAP kinase is inactive, LIN-31 forms a complex with LIN-1/Ets that inhibits vulval cell fates; upon MAP kinase activation (vulval induction), LIN-31 becomes phosphorylated, dissociates from LIN-1, and goes on to promote primary and secondary vulval cell fates; LIN-31 is expressed in the vulval precursor cells.
• Organism: Caenorhabditis elegans
• Automated Description: Enables sequence-specific DNA binding activity. Involved in vulval development. Located in nucleus. Expressed in several structures, including P11.p; P9.p; gonad; nerve ring; and vulval precursor cell. Is an ortholog of human FOXB2 (forkhead box B2).
• Biotype: SO:0001217
• Genetic Position: II :-5.87555 ±0.040806
• Length (nt): 4481

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00003017

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:K10G6.1.1	K10G6.1.1	1381	II: 3982549-3987029

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:K10G6.1	K10G6.1	714	II: 3982654-3982820

18 RNAi Result

• WBRNAi00034268
• WBRNAi00050559
• WBRNAi00086332
• WBRNAi00086333
• WBRNAi00113580
• WBRNAi00008984
• WBRNAi00025944
• WBRNAi00086322
• WBRNAi00086323
• WBRNAi00086330
• WBRNAi00086331
• WBRNAi00086334
• WBRNAi00086335
• WBRNAi00091354
• WBRNAi00091388
• WBRNAi00091357
• WBRNAi00087955
• WBRNAi00091377

127 Allele

• gk963801
• gk963053
• WBVar01695486
• WBVar01791954
• WBVar01791953
• WBVar02123023
• WBVar01791952
• WBVar01993925
• WBVar02123024
• gk961666
• WBVar02029128
• WBVar01626345
• WBVar01626346
• n1301
• WBVar01626347
• WBVar01626348
• ga70
• WBVar01626349
• WBVar01626350
• WBVar02017824
• WBVar01626351
• WBVar01626352
• WBVar00103183
• gk569
• WBVar01902545
• gk941580
• WBVar01916462
• WBVar02071594
• n301
• bx31

1 Chromosome

• WormBase ID: II
• Organism: Caenorhabditis elegans
• Length (nt): 15279421

1 Chromosome Location

• Feature . Primary Identifier: WBGene00003017
• Start: 3982549
• End: 3987029
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrII_3987030..3987249
• Length (nt): 220
• Chromosome Location: II: 3987030-3987249
• Organism: Caenorhabditis elegans

100 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology.	DESEQ2, fold change > 2 and FDR < 0.01.	WBPaper00062103:neuron_enriched
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when no food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_NoFood
	Coexpression clique No. 203, sre-33-ZK1025.1_8337, on the genome-wide coexpression clique map for the nematode GPL200 platform.	All available microarray datasets for the GPL200 platform (Affymetrix C. elegans Genome Array) were obtained from the GEO repository. This included 2243 individual microarray experiments. These were normalized against each other with the software RMAexpress (Bolstad, 2014). Based on these normalized values, Pearsons correlation coefficients were obtained for each probe-probe pair of the 22,620 probes represented on this array type. The resulting list of correlation coefficients was then ranked to generate the ranked coexpression database with information on each probe represented on the GPL200 platform.	WBPaper00061527:sre-33-ZK1025.1_8337
	Transcripts expressed in vulva.	FPKM >= 1.	WBPaper00064122:vulva_transcriptome
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:all-neurons_L2-larva_expressed
	Transcripts that showed significantly increased expression in nuo-6(qm200) comparing to in N2.	Differential gene expression analysis was performed using the quasi-likeli-hood framework in edgeR package v. 3.20.1 in R v. 3.4.1.	WBPaper00053810:nuo-6(qm200)_upregulated
	Transcripts that showed significantly increased expression in hda-1(ne4752[3xFLAG-Degron-HDA-1]) in gonads dissected from 1-day old adult animals.	Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R.	WBPaper00061479:hda-1(ne4752)_upregulated
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:glr-1(+)-neurons_L2-larva_expressed
	Transcripts that showed significantly decreased expression in rbr-2(tm3141) comparing to in N2 animals.	Mapped reads were analyzed for transcript assembly and differential expression using Cufflinks 2.1.1 with a filter of twofold difference and FDR correction (P < 0.05).	WBPaper00050080:rbr-2(tm3141)_downregulated
	Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:hypodermis_L3-L4-larva_expressed
	Transcripts that showed significantly increased expression in ilc-17.1(syb5296) comparing to in N2 animals at L4 larva stage.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00066594:ilc-17.1(syb5296)_upregulated
	Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals.	DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2.	WBPaper00062159:hda-2(ok1479)_upregulated
	Transcripts that showed significantly increased expression in srbc-48(ac23);kyIs262;fer-1(b232ts) comparing to in kyIs262;fer-1(b232ts), 24h after infection with P.aeruginosa.	DESeq2, FDR <0.05, fold change > 2.	WBPaper00059664:srbc-48(ac23)_upregulated
	Transcripts that showed altered expression in cat-1(RNAi) animals comparing to control animals injected with empty vector.	p-value <= 0.05	WBPaper00066902:cat-1(RNAi)_regulated
	Transcripts that showed significantly decreased expression after animals were treated with 100uM Psora and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Psora-Allantoin_downregulated
	Transcripts that showed significantly decreased expression after animals were treated with 100uM Psora from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Psora_downregulated
	Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Allantoin_downregulated
	Transcripts that showed significantly increased expression in dpy-21(e428) comparing to in N2 during L3 stage.	DESeq v1.6.3. Fold change > 1.5.	WBPaper00050370:dpy-21(e428)_L3_upregulated
	Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin and 50mM Metformin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Metformin_downregulated
	Transcripts that showed significantly increased expression in hda-1(RNAi) embryos comparing to control animals.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00067044:hda-1(RNAi)_upregulated
	Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin and 50uM Rifampicin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Rifampicin_downregulated
	Transcripts that showed significantly decreased expression after animals were treated with 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin-Allantoin_downregulated

10 Expression Patterns

• Primary Identifier: Expr6382
• Remark: Strain: BC11267
• Reporter Gene: [lin-31::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TAGTTGCCAAGAGTTGCCG] 3' and primer B 5' [TTGGGATTTTTCAGGGAATATG] 3'.
• Pattern: Adult Expression: intestine; Larval Expression: intestine

• Primary Identifier: Expr7614
• Remark: Clone: pUL#JS5C1
• Pattern: Expression is mainly seen in the developing gonad in the L4 stage larva. In the adult expression appears to be restricted to the spermathecae. This pattern was seen in 2 lines from a total of eight. There is also some faint expression occasionally in 2 nerves in the nerve ring in three lines. Expression is also seen in the posterior of the intestine in some lines and one line gave random seam cell expression in larval and adult animals.

• Primary Identifier: Expr10798
• Pattern: lin-31p::cfp and LIN-12::GFP are expressed in multipotent VPCs during larval (L)2 stage and before induction in the L3 stage. lin-31p::cfp expression remains high in VPCs of dauer larvae. LIN-12::GFP remains expressed in VPCs in dauer larvae.

• Primary Identifier: Expr1086
• Remark: No detailed description on cellular or subcellular expression patterns.
• Pattern: The LIN-31 protein is observed in the nuclei of the VPCs.
• Subcellular Localization: nuclei

• Primary Identifier: Expr1430
• Pattern: LIN-31 is first expressed in the nuclei of P1.p to P11.p (including the vulval precursor cells), from the middle of the first larval (L1) stage until the early L3 stage.
• Subcellular Localization: nuclei

• Primary Identifier: Expr2013174
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1154262
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr1513
• Pattern: The 1.5kb transcript was detected at all developmental stages.

• Primary Identifier: Expr1018210
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr2031406
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

15 GO Annotation

11 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00003017
• Start: 3982549
• End: 3987029
• Strand: 1

15 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 4481

1 Sequence Ontology Term

• Name: gene

19 Strains

• WBStrain00026935
• WBStrain00026941
• WBStrain00026833
• WBStrain00026715
• WBStrain00026743
• WBStrain00026748
• WBStrain00026749
• WBStrain00026747
• WBStrain00027076
• WBStrain00027245
• WBStrain00027156
• WBStrain00027192
• WBStrain00027191
• WBStrain00030622
• WBStrain00036466
• WBStrain00052028
• WBStrain00001694
• WBStrain00004593
• WBStrain00005414

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrII_3981102..3982548
• Length (nt): 1447
• Chromosome Location: II: 3981102-3982548
• Organism: Caenorhabditis elegans