WormMine: Gene WBGene00003112

• WormBase Gene ID: WBGene00003112
• Gene Name: mab-21
• Sequence Name: F35G12.6
• Brief Description: mab-21 encodes a novel protein that is a member of a highly conserved family of proteins with Drosophila and vertebrate orthologs; MAB-21 is cell-autonomously required for specifying the identity of sensory ray 6 in the male tail, and also for backward locomotion, normal body morphology, fecundity, and embryonic morphogenesis; MAB-21 expression begins in embryonic hypodermal cells and continues in larval and adult animals in hypodermis, anterior and ventral cord neurons, some body wall muscles, and ray cells.
• Organism: Caenorhabditis elegans
• Automated Description: Involved in cell fate commitment; embryo development; and nematode male tail mating organ morphogenesis. Expressed in several structures, including PVC; VA2; body wall musculature; ray 6; and sensory neurons. Human ortholog(s) of this gene implicated in coloboma and syndromic microphthalmia 14. Is an ortholog of human MAB21L1 (mab-21 like 1) and MAB21L2 (mab-21 like 2).
• Biotype: SO:0001217
• Genetic Position: III :-3.02765 ±0.006765
• Length (nt): 2300

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00003112

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:F35G12.6.1	F35G12.6.1	1246	III: 4600753-4603052

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:F35G12.6	F35G12.6	1095	III: 4600820-4600852

26 RNAi Result

• WBRNAi00067386
• WBRNAi00002119
• WBRNAi00046400
• WBRNAi00046401
• WBRNAi00014369
• WBRNAi00005031
• WBRNAi00077451
• WBRNAi00030781
• WBRNAi00065907
• WBRNAi00065909
• WBRNAi00069580
• WBRNAi00069579
• WBRNAi00069582
• WBRNAi00069581
• WBRNAi00069584
• WBRNAi00069583
• WBRNAi00069586
• WBRNAi00069585
• WBRNAi00069588
• WBRNAi00069587
• WBRNAi00069590
• WBRNAi00069589
• WBRNAi00069592
• WBRNAi00069591
• WBRNAi00069594
• WBRNAi00069593

30 Allele

• WBVar01263158
• WBVar01263159
• sy155
• h5273
• WBVar01898716
• bx41
• bx43
• bx53
• WBVar01785517
• WBVar01785518
• gk173088
• gk173087
• gk173090
• gk173089
• gk173084
• WBVar01445360
• gk173086
• gk173085
• gk888178
• gk782322
• gk715831
• gk782323
• gk392720
• gk409354
• gk751968
• gk888177
• WBVar01566337
• WBVar01837477
• gk909346
• gk323769

1 Chromosome

• WormBase ID: III
• Organism: Caenorhabditis elegans
• Length (nt): 13783801

1 Chromosome Location

• Feature . Primary Identifier: WBGene00003112
• Start: 4600753
• End: 4603052
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

0 Downstream Intergenic Region

153 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin_upregulated
	Transcripts that showed significantly increased expression after animals were treated with 100uM Psora and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Psora-Allantoin_upregulated
	Transcripts that showed significantly increased expression after animals were treated with 100uM Rapamycin and 50mM Metformin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Metformin_upregulated
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts that showed significantly decreased expression at 5-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites.	DESeq2, fold change > 2, FDR < 0.05	WBPaper00065835:Day5_vs_Day1_downregulated
	Genes that are significantly up regulated in tdp-1(ok803) poly(A) RNA-seq verses in N2.	DESeq v1.14, with cut-off p-value < 0.05 and FDR < 0.1.	WBPaper00046012:tdp-1(ok803)_upregulated
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts that showed significantly decreased expression in atfs-1(cmh15) (null allele) animals comparing to in N2 animals at L4 larva stage.	edgeR, fold change > 2, FDR < 0.05	WBPaper00060909:atfs-1(cmh15)_downregulated
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
	Transcripts that showed significantly increased expression in rrf-3(pk1426) comparing to in N2 at embryo stage.	DESeq2v 1.18.1, fold change > 1.5, adjusted p-value < 0.01.	WBPaper00056169:rrf-3(pk1426)_upregulated_embryo
	Transcripts expressed in vulva.	FPKM >= 1.	WBPaper00064122:vulva_transcriptome
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
	Transcripts that showed significantly increased expression in alg-1(gk214), comparing to in N2.	DESeq2, Fold change > 1.5.	WBPaper00051404:alg-1(gk214)_upregulated
	Genes that showed significantly increased expression in daf-2(e1370);hel-1(gk148684) comparing to in hel-1(gk148684)	To identify DEGs, Students t test and the log2 median ratio test were performed to compute t values and median ratios for all the annotated genes. The adjusted P values from each test were computed using an empirical distribution of the null hypothesis, which was obtained from random permutations of the samples. Finally, the adjusted P values from the individual tests were combined to compute the overall P values using Stouffers method , and genes with overall P < 0.05 and fold change > 1.5 were selected as DEGs.	WBPaper00047131:daf-2(e1370)_upregulated_hel-1(gk148684)-background
	Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage.	DESeq2 version 1.22.2, p < 0.05	WBPaper00064716:paraquat_downregulated
	Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	DESeq2, fold change > 2, adjusted p-value < 0.01	WBPaper00058598:sin-3(tm1276)_downregulated
	Transcripts that showed significantly increased expression in sftb-1(cer6) deletion homozygous comparing to to in N2 animals at L4 larva stage.	DESeq2, fold change > 2	WBPaper00058725:sftb-1(cer6)_downregulated
	Transcripts that showed significantly increased expression in xrep-4(lax137).	DESeq2. Genes were selected if their p value < 0.01.	WBPaper00066062:xrep-4(lax137)_upregulated
	Transcripts that showed significantly increased expression in isp-1(qm150) comparing to in N2.	Differential gene expression analysis was performed using the quasi-likeli-hood framework in edgeR package v. 3.20.1 in R v. 3.4.1.	WBPaper00053810:isp-1(qm150)_upregulated
	Transcripts that showed significantly increased expression in nuo-6(qm200) comparing to in N2.	Differential gene expression analysis was performed using the quasi-likeli-hood framework in edgeR package v. 3.20.1 in R v. 3.4.1.	WBPaper00053810:nuo-6(qm200)_upregulated
	Transcripts that showed significantly increased expression in hpk-1(pk1393) comparing to in N2 at adult day 2.	DESeq 2, fold change > 2, FDR < 0.05.	WBPaper00065581:hpk-1(pk1393)_upregulated
	Transcripts that showed significantly increased expression in pie-1(ne4443[PIE-1-Degron-GFP])	DESeq2. Differentially expressed genes were defined as twofold change and adjusted p-value less than 0.05.	WBPaper00061478:pie-1(ne4433)_upregulated
	Transcripts that showed significantly increased expression in hda-1(ne4752[3xFLAG-Degron-HDA-1]) in gonads dissected from 1-day old adult animals.	Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R.	WBPaper00061479:hda-1(ne4752)_upregulated

12 Expression Patterns

• Primary Identifier: Expr1031471
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr5958
• Remark: Strain: BC12444
• Reporter Gene: [mab-21::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTCTTCTGAACATAGTTGGTGCC] 3' and primer B 5' [CATGTTGGACAAGCGGAAA] 3'.
• Pattern: Adult Expression: intestine; body wall muscle; Larval Expression: intestine

• Primary Identifier: Expr5959
• Remark: Strain: BC12758
• Reporter Gene: [mab-21::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTCTTCTGAACATAGTTGGTGCC] 3' and primer B 5' [CATGTTGGACAAGCGGAAA] 3'.
• Pattern: Adult Expression: body wall muscle; hypodermis; Nervous System; head neurons; Larval Expression: body wall muscle; hypodermis; Nervous System; head neurons

• Primary Identifier: Expr7321
• Pattern: Click the movie links below for interactive 4D movies of a fluorescence reporter. http://glowormnotes.blogspot.com/2009/11/mab-21yfp-transcriptional-fusion.html

• Primary Identifier: Expr1628
• Pattern: In wild-type animals, the mab-21::gfp fluorescent signal was first observed in embryos at the beginning of gastrulation. The expressing cells were dorsal hyp 7 cells before their fusion. From this stage on, the signal could be detected in other larval and adult animals in tissues including hypodermal cells, a group of neuronal cells near the pharyngeal bulbs, neurons along the ventral nerve cord, some body wall muscles and the ray cells. Neuronal cells around the anal ganglia region identified as HOA, HOB in the males as well as PLM, PQR, and PVC. In addition to two unidentified anterior neurons, AVM and VA3 were also confirmed to express mab-21::gfp. The mab-21::gfp fusion transgene was expressed in neuron A of all rays, neuron B of rays 3 and 6 and more importantly, the structural cell of only ray 6.

• Primary Identifier: Expr12562

• Primary Identifier: Expr1150271
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Chronogram398
• Remark: Original chronogram file: chronogram.1410.xml
• Reporter Gene: [F35G12.6:gfp] transcriptional fusion.

• Primary Identifier: Expr2013324
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1026880
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr2031556
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Chronogram1462
• Remark: Original chronogram file: chronogram.34.xml
• Reporter Gene: [F35G12.6:gfp] transcriptional fusion.

4 GO Annotation

10 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00003112
• Start: 4600753
• End: 4603052
• Strand: 1

4 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 2300

1 Sequence Ontology Term

• Name: gene

4 Strains

• WBStrain00030819
• WBStrain00007160
• WBStrain00007166
• WBStrain00002152

0 Upstream Intergenic Region