WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00003043 Gene Name  lip-1
Sequence Name  ? C05B10.1 Brief Description  lip-1 encodes a mitogen-activated protein (MAP) kinase phosphatase homologous to the vertebrate dual specificity phosphatase MKP-3; during development, LIP-1 negatively regulates MAP kinase activity to control the extent of germline proliferation and oocyte meiotic cell cycle progression; lip-1 activity is also required redundantly with dep-1 to negatively regulate MAPK signaling during vulval induction; in addition, lip-1 is required for normal embryonic development; lip-1 expression begins during embryogenesis and continues through adulthood; expression is seen in most somatic cells and in germ cells of the pachytene region, transition zone and proximal-most region of the mitotic zone; in the pachytene region, LIP-1 is associated with the plasma membrane; in early L3 larvae, LIP-1 expression increases in secondary vulval precursor cells in a lin-12/Notch-dependent manner, suggesting that lip-1 may be a direct downstream target of lin-12-mediated signaling; interaction with the Notch pathway is further demonstrated by chromatin immunoprecipitation experiments showing that, in the germline, the lip-1 promoter region coprecipitates with LAG-3; germline lip-1 mRNA accumulation is negatively regulated by the FBF proteins (FBF-1 and FBF-2) that bind to the lip-1 3'UTR.
Organism  Caenorhabditis elegans Automated Description  Predicted to enable MAP kinase tyrosine phosphatase activity; MAP kinase tyrosine/serine/threonine phosphatase activity; and protein tyrosine/threonine phosphatase activity. Involved in several processes, including negative regulation of Ras protein signal transduction; positive regulation of vulval development; and vulval cell fate specification. Located in plasma membrane. Expressed in several structures, including P3.p hermaphrodite; P4.p hermaphrodite; P5.p hermaphrodite; P8.p hermaphrodite; and germ line. Human ortholog(s) of this gene implicated in breast cancer and hypogonadotropic hypogonadism 19 with or without anosmia. Is an ortholog of human DUSP6 (dual specificity phosphatase 6) and DUSP7 (dual specificity phosphatase 7).
Biotype  SO:0001217 Genetic Position  IV :3.24356 ±0.000851
Length (nt)  ? 3054
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00003043

Genomics

3 Transcripts

Class WormMine ID Sequence Name Length (nt) Chromosome Location
MRNA Transcript:C05B10.1b.1 C05B10.1b.1 2011   IV: 6842958-6846011
MRNA Transcript:C05B10.1a.1 C05B10.1a.1 1248   IV: 6842964-6844964
NcPrimaryTranscript Transcript:C05B10.1c C05B10.1c 1200   IV: 6842964-6845152
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:C05B10.1b C05B10.1b 1146   IV: 6842964-6843028
CDS:C05B10.1a C05B10.1a 1110   IV: 6842964-6843028

6 RNAi Result

WormBase ID
WBRNAi00039684
WBRNAi00007925
WBRNAi00010167
WBRNAi00075905
WBRNAi00087228
WBRNAi00087951

45 Allele

Public Name
otn10006
gk964500
gk963722
gk963417
gk963416
gk963493
gk960753
gk946271
WBVar01516295
gt448
zh15
ok5691
zh31
zh32
gk204385
gk204386
gk204384
h6202
gk204393
gk790251
h12616
gk363946
gk204391
gk426315
gk633405
gk204392
gk204389
gk541722
gk204390
gk601377

1 Chromosome

WormBase ID Organism Length (nt)
IV Caenorhabditis elegans 17493829  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00003043 6842958 6846011 1

4 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  
Panther orthologue and paralogue predictions  

1 Downstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrIV_6846012..6846064   53 IV: 6846012-6846064 Caenorhabditis elegans

181 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells. DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction. WBPaper00060811:L1_vs_adult_upregulated_neural
  Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. DESeq. False discovry rate (FDR) < 0.1. WBPaper00048988:neuron_expressed
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
  mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis. Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05. WBPaper00045420:fertilization_downregulated_transcript
Osmotic stress Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present DESeq(version 1.10.1), FDR < 0.05. WBPaper00050726:OsmoticStress_regulated_Food
  Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:arcade_intestinal-valve_expressed
  Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:body-muscle_expressed
  Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:GABAergic-neuron_expressed
  Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:intestine_expressed
  Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:NMDA-neuron_expressed
  Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:pharynx_expressed
  Genes with expression level regulated by genotype (N2 vs CB4856) and age at old adults stage (214 hours at 24 centigrade). For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR). WBPaper00040858:eQTL_age_regulated_aging
Bacteria diet: Escherichia coli HB101. Fed for 30 generations. Transcripts that showed significantly decreased expression after fed by bacteria E. coli HB101 for 30 generations comparing to animals fed by E. coli OP50. DESeq2 fold change > 2, p-value < 0.01. WBPaper00061007:HB101_downregulated
Bacteria diet: Sphingomonas aquatilis Yellow. Fed for 30 generations. Transcripts that showed significantly decreased expression after fed by bacteria Sphingomonas aquatilis (Yellow) for 30 generations comparing to animals fed by E. coli OP50. DESeq2 fold change > 2, p-value < 0.01. WBPaper00061007:S.aquatilis_downregulated
  Transcripts detected in germline isolated from day-1 adult hermaphrodite animals. All three experiments have CPM >= 1. WBPaper00067147:germline_expressed
Bacteria infection: Bacillus thuringiensis mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq. Cuffdiff, ajusted p-value < 0.01. WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
Bacteria infection: Bacillus thuringiensis mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 6h), according to RNAseq. Cuffdiff, ajusted p-value < 0.01. WBPaper00046497:B.thuringiensis_0.5mix_downregulated_6h
  Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2. DESeq2, fold change > 2, p-value < 0.01. WBPaper00061203:sin-3(tm1276)_upregulated
Bacteria infection: Bacillus thuringiensis mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq. Cuffdiff, ajusted p-value < 0.01. WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
  Transcripts that showed significantly increased expression after 24-hour exposure to 10uM benzyl butyl phthalate (BBP) in col-121(nx3) animals. DESeq2v1.38.3, FDR < 0.05 WBPaper00067417:benzyl-butyl-phthalate_regulated
Transgeneration hypoxia treatment. Transcripts that are significantly upregulated in F1 animals after P0 parents were exposed to 0.1% oxygen for 16 hours at L4 larva stage. For calling the significant differentially expressed genes (DEGs),the false discovery rate (FDR) after multiple testing correction was set as 0.05 and analyzed in edgeR. WBPaper00064871:hypoxia_upregulated_F1
Heat Shock: 35C 4 hours at L4 larva stage. Transcripts that showed significantly decreased expression after L4 larva N2 animals were heat stressed at 35C for 4 hours DESeq2 WBPaper00057154:HeatShock_downregulated_mRNA
  Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage. DESeq WBPaper00053302:stavudine_24h_regulated
  Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult. DESeq2, fold change > 2, adjusted p-value < 0.01 WBPaper00058598:sin-3(tm1276)_downregulated
25C vs. 20C Transcripts that showed significantly increased expression in 1-day post L4 adult hermaphrodite N2 grown at 25C, comparing to in N2 animals grown at 20C. CuffDiff, fold change > 2. WBPaper00065096:25C_vs_20C_upregulated
  Transcripts that showed significantly increased expression in 10-days post L4 adult hermaphrodite N2 grown at 20C, comparing to in 1-day post L4 adult hermaphrodite N2 animals grown at 20C. CuffDiff, fold change > 2. WBPaper00065096:Day10_vs_Day1_upregulated
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:A-class-motor-neurons_L2-larva_expressed
Temprature shift to 28C for 24 hours. Transcripts that showed significantly decreased expression after animals were exposed to 28C temperature for 24 hours. Differentially expressed genes wereidentified using DESeq (v.1.18.0) by normalizing readsbased on the negative binomial distribution method andcomparing each HS timepoint to the 0-h control. WBPaper00061341:28C_24h_downregulated
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:all-neurons_L2-larva_expressed
  Transcripts that showed significantly decreased expression in tetraploid N2 comparing to diploid N2 animals at L4 larva stage. DESeq2 R package (1.20.0), fold change > 2, and FDR < 0.05. WBPaper00066110:tetraploid_vs_diploid_downregulated

14 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Also expressed in (comments from author) : Embryo incomplete. To be updated. Strain: BC10399 [lip-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCTGAAACGAACTTATATCGAAAA] 3' and primer B 5' [GTAGGTGAGTTGTGATCTGAAAAT] 3'. Expr5155 Adult Expression: Nervous System; head neurons; tail neurons; unidentified cells; Larval Expression: Nervous System; head neurons; tail neurons; unidentified cells;  
    Expr1031427 Tiling arrays expression graphs  
Picture: Figure 7A''. 7B''. Reporter gene fusion type not specified.   Marker12 Expressed in secondary fate VPC.  
    Expr2215 In wild type gonads, a distinct punctate LIP-1 staining was observed in the region of the distal arm that contains pachytene nuclei. In other regions of the gonad, no specific LIP-1 staining could be detected. The puntate LIP-1 staining was absent in the lip-1(null) mutants. LIP-1 was localized between the densely packed pachytene nuclei that are arranged circumferentailly near the surface of the tubular distal gonad arm. LIP-1 appeared to be concentrated in rod-like structures that measured ~2um in length and extended towards the cytoplasmic core. This specific membrane associated localization of LIP-1 was not observed in other parts of the gonad or in somatic cells.
  [lip-1::nls-gfp] translational fusion and transcriptional fusions. Expr801 LIP-1::GFP expression was observed in most somatic cells starting during embryogenesis and persisting throughout larval development and adulthood. LIP-1::GFP was uniformly expressed at a low level in all VPCs until the L2 stage. In early L3, LIP-1::GFP expression was up-regulated in the secondary VPCs P5.p and P7.p in 71% of [lip-1::nls::gfp] animals. At later stages, LIP-1::GFP expression remained high in the descendants of P5.p and P7.p and low in the descendants of P6.p. LIP-1::GFP was also strongly expressed in hyp7.  
    Marker106 Marker for secondary fate VPC.  
    Expr2013203 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr2031435 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
Original chronogram file: chronogram.2150.xml [C05B10.1:gfp] transcriptional fusion. Chronogram1086    
    Expr1028240 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
Original chronogram file: chronogram.2570.xml [C05B10.1:gfp] transcriptional fusion. Chronogram1324    
    Expr1143779 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  
    Expr3787   LIP-1 staining was concentrated in membrane-associated bright puncta that were easily detectable throughout the pachytene region. Similar LIP-1 puncta was found extending into the transition zone and the proximal-most germ cells of the mitotic region. Closer examination revealed LIP-1 puncta extending distally into the proximal one-third of the mitotic region, but these bright foci were absent from lip-1 null mutants.
    Expr1170001 Time-lapse fluorescence microscopy was performed, including DIC for morphology. Gene expression patterns were summarized in 4 manners: Average over time, Average over time and at different positions along the anterior-posterior (AP) axis, a voxelized representation over time, and on individual cells overlaid from a reference coordinate dataset (https://doi.org/10.1016/j.ydbio.2009.06.014). The analysis was done with a pipeline based on the multi-purpose image analysis software Endrov (https://doi.org/10.1038/nmeth.2478), which further is needed to browse the raw recording data. Thumbnail movies were also generated, using maximum Z projection for the 3D fluorescence channel. Raw recordings available in the Endrov OST-file format are available at https://www.ebi.ac.uk/biostudies/studies/S-BIAD191?query=S-BIAD191  

55 GO Annotation

Annotation Extension Qualifier
  enables
  enables
  enables
  enables
  enables
  involved_in
  involved_in
  enables
  enables
  enables
  enables
  enables
  enables
  involved_in
  involved_in
  involved_in
  involved_in
  involved_in
  involved_in
  involved_in
  involved_in
  involved_in
  involved_in
  involved_in
  involved_in
  involved_in
  involved_in
  involved_in
  involved_in
  involved_in

11 Homologues

Type
orthologue
orthologue
orthologue
least diverged orthologue
least diverged orthologue
least diverged orthologue
least diverged orthologue
orthologue
orthologue
orthologue
least diverged orthologue

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00003043 6842958 6846011 1

55 Ontology Annotations

Annotation Extension Qualifier
  enables
  enables
  enables
  enables
  enables
  involved_in
  involved_in
  enables
  enables
  enables
  enables
  enables
  enables
  involved_in
  involved_in
  involved_in
  involved_in
  involved_in
  involved_in
  involved_in
  involved_in
  involved_in
  involved_in
  involved_in
  involved_in
  involved_in
  involved_in
  involved_in
  involved_in
  involved_in

0 Regulates Expr Cluster

1 Sequence

Length
3054

1 Sequence Ontology Term

Identifier Name Description
gene  

6 Strains

WormBase ID
WBStrain00022639
WBStrain00051597
WBStrain00001321
WBStrain00000146
WBStrain00000141
WBStrain00000142

0 Upstream Intergenic Region