WormMine: Gene WBGene00003410

• WormBase Gene ID: WBGene00003410
• Gene Name: mrp-4
• Sequence Name: F21G4.2
• Brief Description: mrp-4 encodes a putative member of subfamily C of the ATP-binding cassette transporters; MRP-4 is required, redundantly with its paralog WHT-2, for sperm to normally migrate towards a PUFA-based signal exuded by oocytes; hermaphrodites subjected to double wht-2(RNAi) mrp-4(RNAi) are infertile, both through aberrant loss of their own sperm and through failure of males to effectively inseminate them; in mammalian eicosanoid signalling, subfamily C ABC transporters are required for PUFA and eicosanoid transport.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable ATPase-coupled transmembrane transporter activity. Involved in lipid transport involved in lipid storage and lysosome organization. Located in endocytic vesicle and gut granule.
• Biotype: SO:0001217
• Genetic Position: X :1.73094 ±7.7e-05
• Length (nt): 5439

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00003410

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:F21G4.2.1	F21G4.2.1	5068	X: 9884274-9889712

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:F21G4.2	F21G4.2	4722	X: 9884323-9884385

5 RNAi Result

• WBRNAi00045236
• WBRNAi00007620
• WBRNAi00013700
• WBRNAi00086051
• WBRNAi00090692

101 Allele

• gk964260
• gk962707
• gk329252
• gk376492
• gk408855
• gk363334
• gk892107
• gk812731
• gk324257
• gk867034
• gk365540
• gk548835
• gk922735
• gk353494
• gk553616
• gk493934
• gk755165
• gk401230
• gk640804
• gk867639
• gk455546
• gk786389
• gk615223
• h3883
• WBVar01470654
• gk851273
• gk552436
• gk290674
• gk539808
• gk290673

1 Chromosome

• WormBase ID: X
• Organism: Caenorhabditis elegans
• Length (nt): 17718942

1 Chromosome Location

• Feature . Primary Identifier: WBGene00003410
• Start: 9884274
• End: 9889712
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

0 Downstream Intergenic Region

220 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Genes with expression altered >= 3-fold in dpy-10(e128) mutants.	Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)).	WBPaper00035873:dpy-10_regulated
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	Transcripts that showed significantly decreased expression in AGP22 [nhr-49(nr2041)I;glp-1(e2141)III] comparing to in CF1903 [glp-1(e2144)III] at Day 2 adults.	Fold change > 2, p Value of < 0.05 and a false discovery rate (FDR) of < 0.05.	WBPaper00061530:nhr-49(e2144)_downregulated
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
Bacteria infection: Enterococcus faecalis OG1RF. Exposure for 16 hours.	Transcripts that showed significantly decreased expression in N2 after animals were exposed to E. faecalis OG1RF for 16 hours comparing to exposure to E. Coli OP50.	Cuffcompare and Cuffdiff	WBPaper00056090:E.faecalis_downregulated_N2
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
Bacteria diet: Escherichia coli HB101. Fed for 30 generations.	Transcripts that showed significantly decreased expression after fed by bacteria E. coli HB101 for 30 generations comparing to animals fed by E. coli OP50.	DESeq2 fold change > 2, p-value < 0.01.	WBPaper00061007:HB101_downregulated
Bacteria diet: Sphingomonas aquatilis Yellow. Fed for 30 generations.	Transcripts that showed significantly decreased expression after fed by bacteria Sphingomonas aquatilis (Yellow) for 30 generations comparing to animals fed by E. coli OP50.	DESeq2 fold change > 2, p-value < 0.01.	WBPaper00061007:S.aquatilis_downregulated
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
	Transcripts that showed significantly decreased expression in hsp-6(mg585) comparing to in N2 at L4 larva stage.	EdgeR, fold change > 2, FDR < 0.001.	WBPaper00056290:hsp-6(mg585)_downregulated
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M
	Transcripts that showed significantly increased expression in mrg-1(qa6200) comparing to in control animals in primordial germ cells (PGCs) at L1 larva stage.	DESeq2(v1.32.0), FDR < 0.05.	WBPaper00064315:mrg-1(qa6200)_upregulated_PGCs
	Transcripts that showed significantly increased expression in hrde-1(tm1200) animals, comparing to in N2, after growing at 25C for five generations (late generation).	CuffDiff2	WBPaper00051265:F4_hrde-1(tm1200)_upregulated
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
Heat Shock: 35C 4 hours at L4 larva stage.	Transcripts that showed significantly decreased expression after L4 larva N2 animals were heat stressed at 35C for 4 hours	DESeq2	WBPaper00057154:HeatShock_downregulated_mRNA
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage.	DESeq	WBPaper00053302:stavudine_24h_regulated
	Genes down regulated by mir-243(n4759).	RNAs that changed at least 2-fold with a probability of p > 0.05 in three biological replicates were considered differentially regulated between wild-type and mir-243.	WBPaper00036130:mir-243_down_regulated
	Transcripts that showed significantly increased expression in glna-3(syb1403); glna-2(syb1406)glna-1(syb1405) triple knockout mutant comparing to in N2 animals at L1 larva stage.	DESeq2, fold change > 2.	WBPaper00065074:glna(-)_upregulated
25C vs. 20C	Transcripts that showed significantly increased expression in 1-day post L4 adult hermaphrodite N2 grown at 25C, comparing to in N2 animals grown at 20C.	CuffDiff, fold change > 2.	WBPaper00065096:25C_vs_20C_upregulated
	Transcripts that showed significantly increased expression in 10-days post L4 adult hermaphrodite N2 grown at 20C, comparing to in 1-day post L4 adult hermaphrodite N2 animals grown at 20C.	CuffDiff, fold change > 2.	WBPaper00065096:Day10_vs_Day1_upregulated
	Transcripts that showed significantly increased expression in 1-day post L4 adult hermaphrodite npr-8(ok1439) animals grown at 20C, comparing to in N2 animals.	CuffDiff, fold change > 2.	WBPaper00065096:npr-8(ok1439)_upregulated_Day1_20C
Bacteria infection: Pseudomonas aeruginosa PA14. 24 hours of exposure at 25C.	Transcripts that showed significantly increased expression in N2 animals with 24 hours of exposure to P. aeruginosa PA14 for 24 hrs at 25C, comparing to N2 animals without exposure to PA14.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00058948:PA14_upregulated
	Transcripts that showed significantly decreased expression in tetraploid N2 comparing to diploid N2 animals at L4 larva stage.	DESeq2 R package (1.20.0), fold change > 2, and FDR < 0.05.	WBPaper00066110:tetraploid_vs_diploid_downregulated

11 Expression Patterns

• Primary Identifier: Expr4255
• Pattern: This transcriptional reporter showed that mrp-4 is expressed in developing intestinal cells at all stages of development.

• Primary Identifier: Expr4256
• Remark: This MRP-4::GFP fusion protein is at least partially functional as it reverses the suppression of cup-5(zu223) defects by mrp-4(cd8).
• Subcellular Localization: MRP-4::GFP localizes to discrete compartments that partially co-localize with LysoTracker Red in developing intestinal cells. This indicates that at least some MRP-4::GFP localizes to late endocytic compartments. Some compartments stain with MRP-4::GFP but not with LysoTracker Red and may represent other endocytic compartments or cellular organelles. Conversely, some compartments stain with LysoTracker Red but not with MRP-4::GFP: these may constitute lysosomes that are devoid of MRP-4, either because MRP-4 is normally degraded in these compartments or because MRP-4 does not normally traffic to lysosomes but is transported to other organelles.

• Primary Identifier: Expr1031579
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr5819
• Remark: Strain: BC10038
• Reporter Gene: [mrp-4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCATATCACTGGTCATTCCATC] 3' and primer B 5' [gggttcgatccgtatcttct] 3'.
• Pattern: Adult Expression: intestine; Larval Expression: intestine

• Primary Identifier: Expr8024
• Remark: Picture: Figure 3E. The anti-amino terminal MRP-4 antisera was used in the studies presented here; however, identical results were observed using the anti-carboxy terminal MRP-4 antisera.
• Subcellular Localization: Within embryonic intestinal cells, abundant punctate organelles were stained by the anti-MRP-4 antisera. This staining pattern was not present in mrp-4(ok1095), mrp-4(cd8), or mrp-4(RNAi) embryos, confirming the specificity of the antisera.

• Primary Identifier: Expr8023
• Remark: No detailed description on expression pattern in other tissue. Picture: Figures 3A, 3B and S3C to S3F.
• Pattern: Expression of mrp-4::gfp was found in the intestinal cells of mid-stage embryos and adults. Embryonic expression of mrp-4::gfp was first detected in the two intestinal precursors during gastrulation.

• Primary Identifier: Expr2013689
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1022994
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr2031924
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr15747
• Subcellular Localization: Immunofluorescence of embryos expressing a functional DID-2::RFP and MRP-4::GFP showed that while the staining patterns of these two proteins were fairly different, there was still extensive overlap. MRP-4::GFP stains whole membranes of compartments, while DID-2::RFP appears to stain punctate micro-domains on the same membranes or adjacent compartments. These results indicate that MRP-4 and DID-2 localize close to each other on endosomes/lysosomes, consistent with MRP-4 protein being a substrate for DID-2/ESCRT functions.

• Primary Identifier: Expr1149167
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

16 GO Annotation

19 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00003410
• Start: 9884274
• End: 9889712
• Strand: 1

16 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 5439

1 Sequence Ontology Term

• Name: gene

2 Strains

• WBStrain00036002
• WBStrain00007857

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrX_9882213..9884273
• Length (nt): 2061
• Chromosome Location: X: 9882213-9884273
• Organism: Caenorhabditis elegans