WormMine: Gene WBGene00003504

• WormBase Gene ID: WBGene00003504
• Gene Name: mut-7
• Sequence Name: ZK1098.8
• Brief Description: mut-7 encodes a homolog of RnaseD that represses transposition of Tc1, Tc3, Tc4, and Tc5, perhaps by degrading transposon-specific messages; also affects sperm development, sensitivity to RNAi of mainly germline expressed genes, silencing of some germline transgenes, X chromosome loss, and is required for cosuppression (functional silencing of chromosomal loci induced by transgenes) and for silencing induced by antisense RNA oligomers; cellular fractionation experiments indicate that MUT-7 is expressed in adult worms, and resides in a complex in both the cytosol and nucleus; in the cytosolic complex, MUT-7 interacts with RDE-2, a novel protein also required for RNA interference.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable 3'-5'-exoribonuclease activity involved in mature miRNA 3'-end processing. Involved in olfactory learning and regulatory ncRNA-mediated post-transcriptional gene silencing. Located in cytosol; mutator focus; and nucleus. Expressed in AWCL; AWCR; and somatic cell. Is an ortholog of human EXD3 (exonuclease 3'-5' domain containing 3).
• Biotype: SO:0001217
• Genetic Position: III :0.579676 ±0.00167
• Length (nt): 3350

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00003504

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:ZK1098.8.1	ZK1098.8.1	2983	III: 9539031-9542380

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:ZK1098.8	ZK1098.8	2733	III: 9539256-9539433

12 RNAi Result

• WBRNAi00059117
• WBRNAi00021809
• WBRNAi00094399
• WBRNAi00006286
• WBRNAi00069212
• WBRNAi00038150
• WBRNAi00078961
• WBRNAi00062481
• WBRNAi00069214
• WBRNAi00069213
• WBRNAi00069215
• WBRNAi00069211

47 Allele

• gk964518
• gk963887
• pk720
• h6404
• h6403
• WBVar00178051
• pk204
• gk804233
• gk773928
• gk442492
• gk673376
• gk615573
• gk705308
• gk513177
• gk671813
• gk330155
• gk714778
• gk486716
• WBVar01645881
• gk182312
• gk182311
• gk182314
• gk182313
• gk461904
• gk182308
• gk182307
• gk182310
• gk182309
• pk719
• gk671814

1 Chromosome

• WormBase ID: III
• Organism: Caenorhabditis elegans
• Length (nt): 13783801

1 Chromosome Location

• Feature . Primary Identifier: WBGene00003504
• Start: 9539031
• End: 9542380
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrIII_9538706..9539030
• Length (nt): 325
• Chromosome Location: III: 9538706-9539030
• Organism: Caenorhabditis elegans

135 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Transcripts that showed significantly higher expression in somatic gonad precursor cells (SGP) vs. head mesodermal cells (hmc).	DESeq2, fold change >= 2, FDR <= 0.01.	WBPaper00056826:SGP_biased
	Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva fem-3(q20) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-1-adult_vs_L4_upregulated_fem-3(q20)
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141)
	Transcripts that showed significantly increased expression in day 3 adult hermaphrodite comparing to in L4 larva fem-3(q20) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_upregulated_fem-3(q20)
Bacteria diet: Sphingomonas aquatilis Yellow. Fed for 30 generations.	Transcripts that showed significantly decreased expression after fed by bacteria Sphingomonas aquatilis (Yellow) for 30 generations comparing to animals fed by E. coli OP50.	DESeq2 fold change > 2, p-value < 0.01.	WBPaper00061007:S.aquatilis_downregulated
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M
Bacteria infection: Staphylococcus aureus MW2. 4 hours of exposure.	Transcripts that showed significantly increased expression after N2 animals had 4 hours of infection by Staphylococcus aureus (MW2).	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:S.aureus-4h_upregulated_N2
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage.	DESeq	WBPaper00053302:stavudine_24h_regulated
	Genes down regulated by mir-243(n4759).	RNAs that changed at least 2-fold with a probability of p > 0.05 in three biological replicates were considered differentially regulated between wild-type and mir-243.	WBPaper00036130:mir-243_down_regulated
	Transcripts that showed significantly increased expression in 10-days post L4 adult hermaphrodite N2 grown at 20C, comparing to in 1-day post L4 adult hermaphrodite N2 animals grown at 20C.	CuffDiff, fold change > 2.	WBPaper00065096:Day10_vs_Day1_upregulated
Temprature shift to 28C for 24 hours.	Transcripts that showed significantly decreased expression after animals were exposed to 28C temperature for 24 hours.	Differentially expressed genes wereidentified using DESeq (v.1.18.0) by normalizing readsbased on the negative binomial distribution method andcomparing each HS timepoint to the 0-h control.	WBPaper00061341:28C_24h_downregulated
	Transcripts that showed significantly decreased expression in tetraploid N2 comparing to diploid N2 animals at L4 larva stage.	DESeq2 R package (1.20.0), fold change > 2, and FDR < 0.05.	WBPaper00066110:tetraploid_vs_diploid_downregulated
	Proteins that showed significantly decreased expression after 1-day-old wild type adults were exposed to cisplatin (300ug per mL) for 6 hours.	The differential expression analysis was performed in R. Differentially expressed proteins were identified by using a two-sided t-test on log-transformed data.	WBPaper00065373:Cisplatin_downregulated_WT
	Transcripts that showed significantly increased expression in daf-2(e1370) comparing to in N2.	Differential gene expression analysis was performed using the quasi-likeli-hood framework in edgeR package v. 3.20.1 in R v. 3.4.1.	WBPaper00053810:daf-2(e1370)_upregulated
	Transcripts that showed significantly increased expression in ilc-17.1(syb5296) comparing to in N2 animals at L4 larva stage.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00066594:ilc-17.1(syb5296)_upregulated
	Transcripts that showed significantly decreased expression in FACS sorted neuron cells (labelled by pan-neuronal GFP) from edIs6[unc-119::GFP + rol-6(su1006)]; thoc-5(wy822) comparing to in edIs6.	DESeq2, log2 fold change > 2, adjusted p-value < 0.005.	WBPaper00055103:thoc-5(wy822)_downregulated
	Transcripts detected in germline isolated from day-1 adult hermaphrodite animals.	All three experiments have CPM >= 1.	WBPaper00067147:germline_expressed
	Genes that were not enriched in either spermatogenic fem-3(q96gf) nor oogenic fog-2(q71) gonads, according to RNAseq analysis.	To identify differentially expressed transcripts, authors used R/Bioconductor package DESeq.	WBPaper00045521:Gender_Neutral
	Transcripts that showed altered expression from P0 to F2 generation animals after N2 parental generation were treated with antimycin, but not in damt-1(gk961032) P0 to F2 animals after the parenal generaton were treated with antimycin.	N.A.	WBPaper00055862:antimycin_damt-1(gk961032)_regulated
	Transcripts that showed significantly decreased expression in the neurons of bcat-1(RNAi) animals at 5-days post L4 adult hermaphrodite stage, comparing to animals injected with empty vector.	DESeq2. FDR < 0.05.	WBPaper00060459:bcat-1(RNAi)_downregulated
	Transcripts that showed significantly decreased expression in nhl-2(ok818) comparing to in N2 at 25C.	EdgeR, FDR < 0.05, fold change < 0.5.	WBPaper00055971:nhl-2(ok818)_25C_upregulated
	Transcripts that showed decreased expression in hlh-11(ko1) knockout strain comparing to in wild type background.	DESeq2, FDR < 0.05	WBPaper00060683:hlh-11(ko1)_downregulated
Bacteria infection: Enterococcus faecalis OG1RF. Exposure for 16 hours.	Transcripts that showed significantly decreased expression in hpx-2(dg047) after animals were exposed to E. faecalis OG1RF for 16 hours comparing to exposure to E. Coli OP50.	Cuffcompare and Cuffdiff	WBPaper00056090:E.faecalis_downregulated_hpx-2(dg047)
	Transcripts that showed significantly increased expression in set-2(tm1630) animals at embryo stage, comparing to in N2 animals.	DESeq2 (v2.1.8.3) was used to determine DE genes and to generate principal component and scatter plots. DE genes with FDR < 0.05 were analysed using g:Profiler with Bonferroni correction.	WBPaper00060014:set-2(tm1630)_upregulated
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2 at early embryo stage.	DESeq2, FDR < 0.05	WBPaper00058691:sin-3(tm1276)_upregulated
	Genes expressed in N2.	Expressed transcripts were identified on the basis of a Present call in 3 out of 4 N2 experiments as determined by Affymetrix MAS 5.0.	WBPaper00025141:N2_Expressed_Genes

11 Expression Patterns

• Primary Identifier: Expr1031602
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr1162541
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr11234
• Pattern: MUT-7::GFP expression was detected in many cells, including both AWCs.

• Primary Identifier: Expr7182
• Remark: Also expressed in (comments from author) : No comments. Strain: BC14993
• Reporter Gene: [mut-7::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGAAACTCACAATATTTGCCACAA] 3' and primer B 5' [TTCTTCGATTTTCGAAACGG] 3'.
• Pattern: Adult Expression: intestine; rectal gland cells; Reproductive System; vulva other; Nervous System; head neurons; Larval Expression: intestine; rectal gland cells; Reproductive System; developing vulva; Nervous System; head neurons

• Primary Identifier: Expr10155
• Subcellular Localization: MUT-7 fusion protein displayed punctate foci similar to what was observed for MUT-16::GFP, in punctate foci throughout the germline. The brightest and most concentrated foci were in the mitotic region and the transition zone (leptotene/zygotene) regions of the germline. The MUT-7::GFP foci were predominantly perinuclear from the mitotic region through pachytene, but by the diakinesis stage of meiosis, some of the foci had detached from the nuclear periphery and become cytoplasmically localized.The Mutator foci were present during larval stages through adult development and were visible in both hermaphrodite and male germlines.

• Primary Identifier: Expr2013833
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr11748
• Pattern: MUT-7::GFP appeared to be diffuse in somatic cells.

• Primary Identifier: Chronogram1165
• Remark: Original chronogram file: chronogram.2287.xml
• Reporter Gene: [ZK1098.8:gfp] transcriptional fusion.

• Primary Identifier: Expr1016194
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr2032073
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr12342

20 GO Annotation

1 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00003504
• Start: 9539031
• End: 9542380
• Strand: -1

20 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 3350

1 Sequence Ontology Term

• Name: gene

5 Strains

• WBStrain00028975
• WBStrain00028942
• WBStrain00034635
• WBStrain00040468
• WBStrain00003332

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrIII_9542381..9543118
• Length (nt): 738
• Chromosome Location: III: 9542381-9543118
• Organism: Caenorhabditis elegans