WormMine: Gene WBGene00003559

• WormBase Gene ID: WBGene00003559
• Gene Name: ncl-1
• Sequence Name: ZK112.2
• Brief Description: ncl-1 encodes a cytoplasmic B-box zinc finger protein that negatively regulates rRNA and 5S RNA transcription, nucleolus size, and body size; NCL-1 is orthologous to Drosophila BRAIN TUMOR (BRAT), and ncl-1 mutants can be rescued by brat transgenes; NCL-1 is required for the normally small size of neuronal, muscle, and hypodermal nucleoli, and is already active in 4-cell embryos; NCL-1 may be a repressor of RNA polymerase I and III transcription and an inhibitor of cell growth, based on mutant analysis; ncl-1 animals have much larger neuronal nucleoli than normal, somewhat larger muscle and hypodermal nucleoli, but essentially normal intestinal and germline nucleoli (the last of which are large even in wild-type animals); conversely, intestinal and germline cells have the lowest amounts of NCL-1 protein; ncl-1 animals are 9% larger, have 22% more protein and twice as much rRNA, and transcribe rRNA twice as much as wild-type worms; ncl-1 functions cell autonomously, and ncl-1 mutations suppress the tumorous germline phenotype of pro-1(na48) mutants.
• Organism: Caenorhabditis elegans
• Automated Description: Enables translation repressor activity. Involved in several processes, including negative regulation of DNA-templated transcription; negative regulation of ribosome biogenesis; and nucleologenesis. Located in cytoplasm. Expressed in head and tail. Is an ortholog of human TRIM3 (tripartite motif containing 3).
• Biotype: SO:0001217
• Genetic Position: III :-0.630522 ±0.004001
• Length (nt): 18377

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00003559

Genomics

10 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:ZK112.2a.1	ZK112.2a.1	4756	III: 7719729-7738105
Transcript:ZK112.2b.1	ZK112.2b.1	4310	III: 7719791-7737712
Transcript:ZK112.2g.2	ZK112.2g.2	4278	III: 7727119-7737708
Transcript:ZK112.2c.1	ZK112.2c.1	2913	III: 7727136-7736351
Transcript:ZK112.2d.1	ZK112.2d.1	2904	III: 7727136-7736351
Transcript:ZK112.2g.1	ZK112.2g.1	4541	III: 7727739-7738105
Transcript:ZK112.2e.1	ZK112.2e.1	2751	III: 7727784-7736351
Transcript:ZK112.2f.1	ZK112.2f.1	2742	III: 7727784-7736351
Transcript:ZK112.2g.3	ZK112.2g.3	4050	III: 7731387-7737711
Transcript:ZK112.2h.1	ZK112.2h.1	2565	III: 7731521-7736351

Other

8 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:ZK112.2b	ZK112.2b	2949	III: 7719791-7719816
CDS:ZK112.2c	ZK112.2c	2913	III: 7727136-7727283
CDS:ZK112.2g	ZK112.2g	2556	III: 7731521-7731537
CDS:ZK112.2h	ZK112.2h	2565	III: 7731521-7731537
CDS:ZK112.2a	ZK112.2a	2940	III: 7719791-7719816
CDS:ZK112.2d	ZK112.2d	2904	III: 7727136-7727283
CDS:ZK112.2e	ZK112.2e	2751	III: 7727784-7727837
CDS:ZK112.2f	ZK112.2f	2742	III: 7727784-7727837

14 RNAi Result

• WBRNAi00059120
• WBRNAi00059121
• WBRNAi00059123
• WBRNAi00021811
• WBRNAi00021812
• WBRNAi00076868
• WBRNAi00005181
• WBRNAi00005715
• WBRNAi00005763
• WBRNAi00027760
• WBRNAi00069256
• WBRNAi00069255
• WBRNAi00069258
• WBRNAi00069257

268 Allele

• gk964518
• gk963887
• otn11090
• WBVar02067612
• WBVar02067613
• WBVar01566911
• WBVar01607127
• WBVar01607126
• WBVar01607129
• WBVar01607128
• WBVar01265757
• WBVar01265759
• WBVar01265764
• WBVar01265768
• WBVar01265777
• WBVar01820753
• h9942
• h17261
• h5734
• WBVar00564054
• WBVar00564056
• WBVar00564053
• e1942
• WBVar01645516
• WBVar01645517
• WBVar01645514
• WBVar01645515
• WBVar01331091
• WBVar01331092
• WBVar01331086

1 Chromosome

• WormBase ID: III
• Organism: Caenorhabditis elegans
• Length (nt): 13783801

1 Chromosome Location

• Feature . Primary Identifier: WBGene00003559
• Start: 7719729
• End: 7738105
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

0 Downstream Intergenic Region

161 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:all-neurons_L1-larva_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
	Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals.	Fold change > 2, FDR < 0.01.	WBPaper00065993:glp-1(e2141)_upregulated
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
	Transcripts expressed in vulva.	FPKM >= 1.	WBPaper00064122:vulva_transcriptome
	Transcripts detected in germline isolated from day-1 adult hermaphrodite animals.	All three experiments have CPM >= 1.	WBPaper00067147:germline_expressed
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
	Transcripts that showed significantly increased expression after four-day-old young adult worms were placed on NGM plates seeded with OP50 in the presence 5% Agaro-oligosaccharides(AGO) for 24 h, comparing to animals grown in the absence of AGO.	Fold change > 2.	WBPaper00064306:Agaro-oligosaccharides_upregulated
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
	Significantly upregulated genes from clk-1(qm30) microarrays using SAM algorithm with an FDR < 0.1 from adult-only chips.	SAM algorithm with an FDR < 0.1.	WBPaper00033065:clk-1(qm30)_upregulated
	Significantly differentially expressed genes as determined by microarray analysis of wild-type and cde-1 mutant germlines.	RNAs that changed at least 2-fold with a probability of p < 0.05 were considered differentially regulated between wildtype and cde-1.	WBPaper00035269:cde-1_regulated
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage.	DESeq	WBPaper00053302:stavudine_24h_regulated
	Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy.	Cufflinks	WBPaper00065120:body-muscle-transcriptome
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:A-class-motor-neurons_L2-larva_expressed
	Proteins that showed significantly decreased expression after 1-day-old wild type adults were exposed to cisplatin (300ug per mL) for 6 hours.	The differential expression analysis was performed in R. Differentially expressed proteins were identified by using a two-sided t-test on log-transformed data.	WBPaper00065373:Cisplatin_downregulated_WT
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:coelomocytes_L2-larva_expressed

14 Expression Patterns

• Primary Identifier: Expr1031621
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr1162544
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr1162545
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr7185
• Remark: Strain: BC12760
• Reporter Gene: [ncl-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTGCGCCCATTCTCTCAT] 3' and primer B 5' [GGCACTGTGGACAGATGATG] 3'.
• Pattern: Adult Expression: pharynx; intestine; body wall muscle; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; intestine; body wall muscle; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr7187
• Remark: Strain: BC12631
• Reporter Gene: [ZK112.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TAGGCGAGAAAAATAAGAAGGCT] 3' and primer B 5' [ACGGTAGATTTGGATTTGGTATGT] 3'.
• Pattern: Adult Expression: anal depressor muscle; unidentified cells in head; Larval Expression: anal depressor muscle; unidentified cells in head

• Primary Identifier: Expr7186
• Remark: Also expressed in (comments from author) : Mosaic population. Strain: BC12908
• Reporter Gene: [ZK112.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TAGGCGAGAAAAATAAGAAGGCT] 3' and primer B 5' [ACGGTAGATTTGGATTTGGTATGT] 3'.
• Pattern: Adult Expression: anal depressor muscle; Nervous System; head neurons; unidentified cells in head; Larval Expression: anal depressor muscle; Nervous System; head neurons; unidentified cells in head

• Primary Identifier: Expr2013907
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Chronogram1667
• Remark: Original chronogram file: chronogram.58.xml
• Reporter Gene: [ZK112.2:gfp] transcriptional fusion.

• Primary Identifier: Expr2032147
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1014547
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr1402
• Remark: No detailed description on cellular expression pattern.
• Subcellular Localization: In 300-cell stage embryos: Immunostaining with mAb D3C2 showed that NCL-1 is present in the cytoplasm of all cells except those of the developing gut. In early embryos in which nucleoli are not detectable in wild-type: Indirect immunofluorescence using mAb D3C2 showed that in wild-type embryos, NCL-1 is a cytoplasmic protein with no obvious nuclear accumulation. NCL-1 staining is abundant in early embryos and then rapidly diminishes during development. No staining was detected with mAb D3C2 in ncl-1 (e1942) mutant embryos at any stage. In the hermaphrodite gonad: Nucleoli are visible in the syncytial gonad of adult hermaphrodites but disappear as oocytes mature. Cytoplasmic NCL-1 staining is absent in the mitotic region of the syncytial gonad, low in the meiotic region, and then increases throughout oocyte maturation such that the most intense staining is seen in the most mature oocyte.

• Primary Identifier: Expr1027301
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Chronogram1559
• Remark: Original chronogram file: chronogram.43.xml
• Reporter Gene: [ZK112.3:gfp] transcriptional fusion.

• Primary Identifier: Expr1040009
• Pattern: Tiling arrays expression graphs

18 GO Annotation

15 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00003559
• Start: 7719729
• End: 7738105
• Strand: 1

18 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 18377

1 Sequence Ontology Term

• Name: gene

76 Strains

• WBStrain00022526
• WBStrain00026695
• WBStrain00027300
• WBStrain00028775
• WBStrain00030874
• WBStrain00034401
• WBStrain00034416
• WBStrain00034377
• WBStrain00034379
• WBStrain00034378
• WBStrain00034391
• WBStrain00034390
• WBStrain00034395
• WBStrain00034396
• WBStrain00036965
• WBStrain00007984
• WBStrain00007983
• WBStrain00007478
• WBStrain00007477
• WBStrain00000870
• WBStrain00000869
• WBStrain00000868
• WBStrain00000867
• WBStrain00000866
• WBStrain00000865
• WBStrain00000863
• WBStrain00000862
• WBStrain00000861
• WBStrain00000903
• WBStrain00000902

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrIII_7717315..7719728
• Length (nt): 2414
• Chromosome Location: III: 7717315-7719728
• Organism: Caenorhabditis elegans