WormMine: Gene WBGene00003890

• WormBase Gene ID: WBGene00003890
• Gene Name: osm-10
• Sequence Name: T20H4.1
• Brief Description: osm-10 encodes a novel protein conserved amongst several Caenorhabditis species; osm-10 activity is required for normal osmosensory signaling in the ASH sensory neuron; in regulating ASH-mediated osmosensation, osm-10 interacts genetically with eos-1 and eos-2; OSM-10 is expressed in the ASH, ASI, PHA, and PHB sensory neurons beginning just prior to hatching and continuing through larval and adult stages; OSM-10 localizes to cell bodies, sensory processes, and axons.
• Organism: Caenorhabditis elegans
• Automated Description: Enables osmosensor activity. Involved in osmosensory signaling pathway. Located in axon; cytoplasm; and neuronal cell body.
• Biotype: SO:0001217
• Genetic Position: III :-0.764685 ±0.000739
• Length (nt): 2467

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00003890

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:T20H4.1a.1	T20H4.1a.1	1658	III: 7243280-7245743
Transcript:T20H4.1b.1	T20H4.1b.1	1542	III: 7243318-7245746

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:T20H4.1b	T20H4.1b	1179	III: 7243363-7243395
CDS:T20H4.1a	T20H4.1a	1260	III: 7243363-7243395

5 RNAi Result

• WBRNAi00053670
• WBRNAi00018934
• WBRNAi00065896
• WBRNAi00005588
• WBRNAi00035727

30 Allele

• gk964518
• gk963887
• WBVar01656993
• gk560551
• gk762789
• gk488676
• WBVar01952356
• gk630581
• gk488675
• gk804702
• gk456708
• gk404348
• nr2076
• gk525182
• gk562352
• gk911764
• WBVar02053334
• WBVar00064202
• WBVar00064207
• WBVar01722881
• gk178084
• gk178086
• WBVar01722880
• gk178085
• n1602
• WBVar00059695
• WBVar01995497
• WBVar00059700
• gk1863
• WBVar00059705

1 Chromosome

• WormBase ID: III
• Organism: Caenorhabditis elegans
• Length (nt): 13783801

1 Chromosome Location

• Feature . Primary Identifier: WBGene00003890
• Start: 7243280
• End: 7245746
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

0 Downstream Intergenic Region

108 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
	TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood.	SAM	WBPaper00031040:TGF-beta_adult_upregulated
	Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology.	DESEQ2, fold change > 2 and FDR < 0.01.	WBPaper00062103:neuron_enriched
	Transcripts that showed significantly increased expression in csr-1a(tor159) comparing to in N2 at 25C.	DESeq2, fold change > 2, p-value < 0.05.	WBPaper00061753:csr-1(tor159)_upregulated_25C
	Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals.	Fold change > 2, FDR < 0.01.	WBPaper00065993:glp-1(e2141)_upregulated
	Transcripts that showed significantly increased expression in ogt-1(ok1474) neuronal cells isolated by FACs comparing to in FACs isolated neuronal cells from wild type.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00066485:ogt-1(ok1474)_upregulated_neuron
Bacteria infection: Enterococcus faecalis	Genes with increased expression after 24 hours of infection by E.faecalis Fold changes shown are pathogen vs OP50.	For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated.	WBPaper00038438:E.faecalis_24hr_upregulated_TilingArray
	Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin_upregulated
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_daf-16(mu86);glp-1(e2141)
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141)
	Transcripts that showed significantly increased expression in rrf-3(pk1426) comparing to in N2 at embryo stage.	DESeq2v 1.18.1, fold change > 1.5, adjusted p-value < 0.01.	WBPaper00056169:rrf-3(pk1426)_upregulated_embryo
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
	Genes that showed significantly increased expression in daf-2(e1370);hel-1(gk148684) comparing to in hel-1(gk148684)	To identify DEGs, Students t test and the log2 median ratio test were performed to compute t values and median ratios for all the annotated genes. The adjusted P values from each test were computed using an empirical distribution of the null hypothesis, which was obtained from random permutations of the samples. Finally, the adjusted P values from the individual tests were combined to compute the overall P values using Stouffers method , and genes with overall P < 0.05 and fold change > 1.5 were selected as DEGs.	WBPaper00047131:daf-2(e1370)_upregulated_hel-1(gk148684)-background
	Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage.	DESeq2 version 1.22.2, p < 0.05	WBPaper00064716:paraquat_downregulated
	Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	DESeq2, fold change > 2, adjusted p-value < 0.01	WBPaper00058598:sin-3(tm1276)_downregulated
	Transcripts that showed significantly increased expression in xrep-4(lax137).	DESeq2. Genes were selected if their p value < 0.01.	WBPaper00066062:xrep-4(lax137)_upregulated
	Genes with increased RNA expression after 24 hours rotenone treatment	EdgeR provides statistical routines for determining differential expression in digital gene expression data using a model based on the negative binomial distribution. The resulting p-values were adjusted using the Benjamini and Hochbergs approach for controlling the false discovery rate (FDR). Transcripts with an adjusted p-value smaller 0.05 were assigned as differentially expressed.	WBPaper00044426:rotenone_24h_upregulated
	Transcripts that showed significantly increased expression in daf-2(e1370) comparing to in N2.	Differential gene expression analysis was performed using the quasi-likeli-hood framework in edgeR package v. 3.20.1 in R v. 3.4.1.	WBPaper00053810:daf-2(e1370)_upregulated
	Transcripts that showed significantly increased expression in nuo-6(qm200) comparing to in N2.	Differential gene expression analysis was performed using the quasi-likeli-hood framework in edgeR package v. 3.20.1 in R v. 3.4.1.	WBPaper00053810:nuo-6(qm200)_upregulated
	Transcripts that showed significantly increased expression in hpk-1(pk1393) comparing to in N2 at adult day 2.	DESeq 2, fold change > 2, FDR < 0.05.	WBPaper00065581:hpk-1(pk1393)_upregulated
	Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals.	DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2.	WBPaper00062159:hda-2(ok1479)_upregulated
	Transcripts that showed significantly increased expression in srbc-48(ac23);kyIs262;fer-1(b232ts) comparing to in kyIs262;fer-1(b232ts), 24h after infection with P.aeruginosa.	DESeq2, FDR <0.05, fold change > 2.	WBPaper00059664:srbc-48(ac23)_upregulated
	Genes expressed in N2.	Expressed transcripts were identified on the basis of a Present call in 3 out of 4 N2 experiments as determined by Affymetrix MAS 5.0.	WBPaper00025141:N2_Expressed_Genes
	Transcripts that showed significantly increased expression in emb-4(hc60) comparing to in N2.	DESeq2	WBPaper00052884:emb-4(hc60)_upregulated
	Transcripts that showed significantly increased expression in sma-2(rax5) comparing to in N2 at 1-day post-L4 adult hermaphrodite	HTseq-count was used to count reads mapped to each gene and counting data was imported to EdgeR for statistical analysis. Statistical significance was defined by adjusted P value (false discovery rate, FDR) of <0.05.	WBPaper00053184:sma-2(rax5)_upregulated

10 Expression Patterns

• Primary Identifier: Expr1031833
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr6725
• Remark: Strain: BC12584
• Reporter Gene: [osm-10::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAACTATCGTTTTAAATTCCGCAG] 3' and primer B 5' [GACGTTGCCTTCGACATCTT] 3'.
• Pattern: Adult Expression: Nervous System; head neurons; amphids; tail neurons; phasmids; Larval Expression: Nervous System; head neurons; amphids; tail neurons; phasmids

• Primary Identifier: Expr15400

• Primary Identifier: Expr515
• Remark: Strain contained dpy-20(e1282). Transgenic Marker: dpy-20+.
• Pattern: Expressed in a subset of amphids and in phasmids.

• Primary Identifier: Expr1266
• Pattern: Expressed in four classes of chemosensory neurons in all larval and adult animals (ASH, ASI, PHA, and PHB). Expression commences just before hatching. OSM-10 expression was never observed in any other cells.
• Subcellular Localization: The OSM-10 protein was uniformly distributed throughout the cell bodies, sensory processes, and axons of the expressing cells but was excluded from nuclei on the basis of confocal resolution microscopy.

• Primary Identifier: Chronogram614
• Remark: Original chronogram file: chronogram.1643.xml
• Reporter Gene: [T20H4.1:gfp] transcriptional fusion.

• Primary Identifier: Expr1022236
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr1157225
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr2032872
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr2014639
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

12 GO Annotation

13 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00003890
• Start: 7243280
• End: 7245746
• Strand: 1

12 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 2467

1 Sequence Ontology Term

• Name: gene

6 Strains

• WBStrain00027082
• WBStrain00029473
• WBStrain00008293
• WBStrain00008292
• WBStrain00008294
• WBStrain00008277

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrIII_7242951..7243279
• Length (nt): 329
• Chromosome Location: III: 7242951-7243279
• Organism: Caenorhabditis elegans