WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00004008 Gene Name  pgp-14
Sequence Name  ? F22E10.3 Brief Description  pgp-14 encodes a member of the ABC transporter family with high similarity to the vertebrate MDR (multidrug resistance) family; PGP-14 is predicted to function as a transmembrane protein that couples energy to transport of various molecules across membranes, but as loss of pgp-14 activity via large-scale RNAi screens does not result in any obvious defects, the precise role of pgp-14 in C. elegans development and/or behavior is not yet known; pgp-14 promoter-gfp fusion proteins are expressed in larvae and adults in the anterior pharynx.
Organism  Caenorhabditis elegans Automated Description  Predicted to enable ATPase-coupled transmembrane transporter activity. Involved in response to nematicide. Predicted to be located in membrane. Human ortholog(s) of this gene implicated in several diseases, including autoimmune disease (multiple); carcinoma (multiple); and hematologic cancer (multiple). Is an ortholog of human ABCB1 (ATP binding cassette subfamily B member 1); ABCB4 (ATP binding cassette subfamily B member 4); and ABCB5 (ATP binding cassette subfamily B member 5).
Biotype  SO:0001217 Genetic Position  X :8.21375 ±0.008856
Length (nt)  ? 4858
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00004008

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:F22E10.3.1 F22E10.3.1 4293   X: 12744723-12749580
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:F22E10.3 F22E10.3 3984   X: 12745007-12745207

4 RNAi Result

WormBase ID
WBRNAi00000347
WBRNAi00045324
WBRNAi00013753
WBRNAi00077361

62 Allele

Public Name
gk964260
gk964029
gk962707
gk964028
gk963810
WBVar01691104
WBVar01691103
WBVar01691105
WBVar01759682
gk297101
gk297100
gk297099
gk297105
gk297104
gk297103
gk297102
WBVar01471762
WBVar01471761
WBVar00083619
h9302
WBVar01817047
WBVar01817046
WBVar01621878
gk619360
gk736911
gk723135
gk443419
gk907254
gk825566
gk932377

1 Chromosome

WormBase ID Organism Length (nt)
X Caenorhabditis elegans 17718942  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00004008 12744723 12749580 -1

4 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  
Panther orthologue and paralogue predictions  

0 Downstream Intergenic Region

244 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts of coding genes that showed significantly decreased expression in muscle. DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed. WBPaper00062325:muscle_depleted_coding-RNA
  Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. DESeq. False discovry rate (FDR) < 0.1. WBPaper00048988:neuron_expressed
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
  mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis. Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05. WBPaper00045420:fertilization_downregulated_transcript
  TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood. SAM WBPaper00031040:TGF-beta_adult_upregulated
  Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals. Fold change > 2, FDR < 0.01. WBPaper00065993:glp-1(e2141)_upregulated
  Transcripts that showed significantly increased expression in ogt-1(ok1474) neuronal cells isolated by FACs comparing to in FACs isolated neuronal cells from wild type. DESeq2, fold change > 2, FDR < 0.05. WBPaper00066485:ogt-1(ok1474)_upregulated_neuron
  Genes that showed significantly increased expression in wrn-1(gk99) comparing to in N2, according to RNAseq. DESeq was used to calculate the fold changes, log fold changes, and significance of the changes for each comparison. WBPaper00045934:wrn-1(gk99)_upregulated
  Proteins interacting with NHR-49-GFP according to co-IP and LC-MS. N.A. WBPaper00064071:NHR-49_interacting
  Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:arcade_intestinal-valve_expressed
  Transcripts that showed significantly decreased expression at 5-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites. DESeq2, fold change > 2, FDR < 0.05 WBPaper00065835:Day5_vs_Day1_downregulated
  Transcripts that showed significantly decreased expression at 11-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites. DESeq2, fold change > 2, FDR < 0.05 WBPaper00065835:Day11_vs_Day1_downregulated
  Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals. Fold change > 2, FDR < 0.05 WBPaper00064088:Day-1-adult_vs_L4_upregulated_daf-16(mu86);glp-1(e2141)
  Transcripts that showed significantly decreased expression in hsp-6(mg585) comparing to in N2 at L4 larva stage. EdgeR, fold change > 2, FDR < 0.001. WBPaper00056290:hsp-6(mg585)_downregulated
  Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2. DEseq 1.18.0, adjusted p-value < 0.05. WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
Bacteria infection: Staphylococcus aureus MW2. 4 hours of exposure. Transcripts that showed significantly increased expression after N2 animals had 4 hours of infection by Staphylococcus aureus (MW2). DEseq 1.18.0, adjusted p-value < 0.05. WBPaper00056471:S.aureus-4h_upregulated_N2
  Transcripts that showed significantly increased expression in alg-1(gk214), comparing to in N2. DESeq2, Fold change > 1.5. WBPaper00051404:alg-1(gk214)_upregulated
  Transcripts that showed significantly increased expression in adr-1(tm668) and adr-1(gv6) comparing to in N2 at embryo stage. DESeq FDR <= 0.05 WBPaper00056617:adr-1_upregulated_embryo_transcript
  Genes that showed significantly increased expression in daf-2(e1370);hel-1(gk148684) comparing to in hel-1(gk148684) To identify DEGs, Students t test and the log2 median ratio test were performed to compute t values and median ratios for all the annotated genes. The adjusted P values from each test were computed using an empirical distribution of the null hypothesis, which was obtained from random permutations of the samples. Finally, the adjusted P values from the individual tests were combined to compute the overall P values using Stouffers method , and genes with overall P < 0.05 and fold change > 1.5 were selected as DEGs. WBPaper00047131:daf-2(e1370)_upregulated_hel-1(gk148684)-background
  Genes that showed significantly increased expression in daf-2(e1370) comparing to in N2. To identify DEGs, Students t test and the log2 median ratio test were performed to compute t values and median ratios for all the annotated genes. The adjusted P values from each test were computed using an empirical distribution of the null hypothesis, which was obtained from random permutations of the samples. Finally, the adjusted P values from the individual tests were combined to compute the overall P values using Stouffers method , and genes with overall P < 0.05 and fold change > 1.5 were selected as DEGs. WBPaper00047131:daf-2(e1370)_upregulated_N2-background
  Transcripts that showed significantly decreased expression in Day 5 (5-days post-L4) vs. Day 0 (L4 larva) of adulthood N2 animals. Differential expression for both small RNA- and mRNA-seq data was tested using DESeq2; P-values were adjusted for multiple testing by Benjamini-Hochberg method. WBPaper00053318:Aging_downregulated_mRNA_N2
  Expression Pattern Group C, enriched for genes involved in metabolic processes. The significance (P 0.0001) of the relative age (time) was used to determine if a gene was differentially expressed between the three age (time) groups. The effect of this factor explaining gene expression differences was used to determine if the expression went up or down during the two age/time periods (t1 - t2 and t2 -t3). Authors used a permutation approach to determine the thresholds for the different mapping strategies. For each of the used models for eQTL mapping, authors used 23,000 permutations. For each permutation, authors randomly picked a spot; each spot could only be picked once. The gene expression and relative lifespan values were than randomly distributed over the RILs (and time points) and used for mapping. In this way, authors obtained a threshold for each of the explaining factors. For the single time points, authors used a FDR of 0.01 to adjust for multiple testing. The genome-wide threshold for this FDR is -log10 P = 3.8 for each of the three time points. For the combined models (t1 to t2 and t2 to t3), authors used a genome-wide threshold of -log10 P = 4, which resembles an FDR of 0.006, 0.001, and 0.006 for marker, age, and the interaction between marker and age, respectively. To determine the threshold for the single gene examples, authors used 1000 permutations as in the genome-wide threshold. The difference is that they use the gene under study in all of the permutations. The P-values for the gene specific thresholds were determined at FDR = 0.05. WBPaper00036286:Pattern_C
  Transcripts that showed significantly increased expression in animal with pgph-2 overepxreesion [pgph-2p-pgph-2; myo-2p-mcherry] in glucose excess condition. Genes with anadjusted P-value <= 0.05 found by DESeq2 were assigned as differentially expressed. WBPaper00065926:pgph-2(overepxreesion)_upregulated_glucose
  Transcripts depleted in purified oocyte P bodies comparing to in the whole animal. DESeq2, FDR < 0.05, fold change > 2. WBPaper00065975:P-body_vs_WholeAnimal_depleted
  Transcripts that showed significantly increased expression in xrep-4(lax137). DESeq2. Genes were selected if their p value < 0.01. WBPaper00066062:xrep-4(lax137)_upregulated
  Transcripts that showed significantly increased expression in animals with germline-specific inx-14(RNAi) comparing to in aniamls fed with control vector, both exposed to PA14 infection. DESeq2. Differentially-expressed genes (DEG) were identified based on two criteria: FDR (False discovery rateusing Benjamini-Hochberg adjusted p-values) < 0.01 and absolute value of log2(Fold Change) > 1. WBPaper00066146:germline-inx-14(RNAi)_upregulated_PA14
  Genes that showed oscillating mRNA expression level throughout the 16 hour time courses from L3 larva to young adult. The following three lines of R code were used to perform the classification: increasing <-2*amplitude-PC1 < -1.7; oscillating <-!increasing & (amplitude > 0.55); flat <-!increasing & !oscillating; Note that the amplitude of a sinusoidal wave corresponds to only half the fold change between trough and peak. WBPaper00044736:oscillating_dev_expression
  Transcripts that showed significantly increased expression in hda-1(ne4752[3xFLAG-Degron-HDA-1]) in gonads dissected from 1-day old adult animals. Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R. WBPaper00061479:hda-1(ne4752)_upregulated
  Transcripts that showed significantly increased expression in set-9(rw5) animals comparing to in N2. edgeR, 5% FDR. WBPaper00054410:set-9(rw5)_upregulated
  Transcripts that showed significantly increased expression in wdr-23(mac32) embryos from parents fed with E. coliHB101, comparing to N2 embryos parents fed with E. coli HB101. DESeq2, Fold Change > 2 or < 0.5. WBPaper00059566:wdr-23(mac32)_upregulated

8 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
    Expr4618 Expressed in: pharynx.  
    Expr1031917 Tiling arrays expression graphs  
Strain: BC12036 [pgp-14::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTCTGTGACCTGTACTGCGACT] 3' and primer B 5' [CGTCTTTAGGGGCGATGTT] 3'. Expr5828 Adult Expression: pharynx; Larval Expression: pharynx;  
    Expr3326 Expressed strongly in anterior and 1st bulb of pharynx, 3 isolates.  
    Expr3327 Expressed strongly in anterior pharynx, 2 isolates.  
    Expr2014867 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr2033102 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr1149248 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  

12 GO Annotation

Annotation Extension Qualifier
  enables
  enables
  enables
  enables
  enables
  located_in
  located_in
  located_in
  involved_in
  located_in
  involved_in
  involved_in

4 Homologues

Type
orthologue
orthologue
orthologue
orthologue

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00004008 12744723 12749580 -1

12 Ontology Annotations

Annotation Extension Qualifier
  enables
  enables
  enables
  enables
  enables
  located_in
  located_in
  located_in
  involved_in
  located_in
  involved_in
  involved_in

0 Regulates Expr Cluster

1 Sequence

Length
4858

1 Sequence Ontology Term

Identifier Name Description
gene  

2 Strains

WormBase ID
WBStrain00032692
WBStrain00001996

0 Upstream Intergenic Region