WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00003859 Gene Name  oig-1
Sequence Name  ? C09E7.3 Organism  Caenorhabditis elegans
Automated Description  Involved in neuron remodeling. Predicted to be located in extracellular region; membrane; and neuron projection. Expressed in neurons. Biotype  SO:0001217
Genetic Position  III :-1.09923 ±0.004864 Length (nt)  ? 1607
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00003859

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:C09E7.3.1 C09E7.3.1 500   III: 6524051-6525657
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:C09E7.3 C09E7.3 414   III: 6524102-6524248

4 RNAi Result

WormBase ID
WBRNAi00097920
WBRNAi00040189
WBRNAi00040190
WBRNAi00007110

28 Allele

Public Name
gk964518
gk964032
gk964033
WBVar01264452
WBVar01823291
WBVar01645138
gk883830
gk821134
gk531525
gk407669
gk385082
gk537453
WBVar02010565
WBVar01995393
WBVar01995394
ok1687
WBVar01566697
gk176762
gk176768
gk176767
WBVar01990121
gk176770
gk176769
gk176764
gk176763
gk176766
gk176765
gk3204

1 Chromosome

WormBase ID Organism Length (nt)
III Caenorhabditis elegans 13783801  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00003859 6524051 6525657 -1

3 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  

1 Downstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrIII_6520050..6524050   4001 III: 6520050-6524050 Caenorhabditis elegans

120 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells. DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction. WBPaper00060811:L1_vs_adult_upregulated_neural
  Transcripts of coding genes that showed significantly decreased expression in muscle. DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed. WBPaper00062325:muscle_depleted_coding-RNA
  Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. DESeq. False discovry rate (FDR) < 0.1. WBPaper00048988:neuron_expressed
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
Osmotic stress Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present DESeq(version 1.10.1), FDR < 0.05. WBPaper00050726:OsmoticStress_regulated_Food
  Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology. DESEQ2, fold change > 2 and FDR < 0.01. WBPaper00062103:neuron_enriched
  Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:GABAergic-neuron_expressed
  Genes that are significantly up regulated in tdp-1(ok803) poly(A) RNA-seq verses in N2. DESeq v1.14, with cut-off p-value < 0.05 and FDR < 0.1. WBPaper00046012:tdp-1(ok803)_upregulated
  Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:hypodermis_expressed
  Genes with expression level regulated by genotype (N2 vs CB4856) and age at old adults stage (214 hours at 24 centigrade). For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR). WBPaper00040858:eQTL_age_regulated_aging
  Transcripts that showed significantly increased expression in rrf-3(pk1426) comparing to in N2 at embryo stage. DESeq2v 1.18.1, fold change > 1.5, adjusted p-value < 0.01. WBPaper00056169:rrf-3(pk1426)_upregulated_embryo
  Transcripts that showed significantly altered expression at URX, AQR, and PQR neurons in camt-1(ok515) animals comparing to in wild type AX1888-1 strain. RNA-seq data were mapped using PRAGUI - a Python 3-based pipeline for RNA-seq data analysis. WBPaper00061902:camt-1(ok515)_regulated_URX-AQR-PQR
  Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals. DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2. WBPaper00062159:hda-2(ok1479)_upregulated
  Transcripts that showed significantly increased expression in srbc-48(ac23);kyIs262;fer-1(b232ts) comparing to in kyIs262;fer-1(b232ts), 24h after infection with P.aeruginosa. DESeq2, FDR <0.05, fold change > 2. WBPaper00059664:srbc-48(ac23)_upregulated
  Transcripts that showed significantly decreased expression after animals were treated with 100uM Psora and 250uM Allantoin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Psora-Allantoin_downregulated
  Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin and 250uM Allantoin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Rapamycin-Allantoin_downregulated
  Transcripts that showed significantly increased expression in dpy-21(e428) comparing to in N2 during L3 stage. DESeq v1.6.3. Fold change > 1.5. WBPaper00050370:dpy-21(e428)_L3_upregulated
  Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin and 50mM Metformin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Rapamycin-Metformin_downregulated
  Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin and 50uM Rifampicin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Rapamycin-Rifampicin_downregulated
  Transcripts that showed significantly decreased expression after animals were treated with 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Rifampicin-Allantoin_downregulated
  Transcripts that showed significantly increased expression in ilc-17.1(syb5296) comparing to in N2 animals at L4 larva stage. DESeq2, fold change > 2, FDR < 0.05. WBPaper00066594:ilc-17.1(syb5296)_upregulated
  Genes expressed in N2. Expressed transcripts were identified on the basis of a Present call in 3 out of 4 N2 experiments as determined by Affymetrix MAS 5.0. WBPaper00025141:N2_Expressed_Genes
  Transcripts that showed significantly increased expression in emb-4(hc60) comparing to in N2. DESeq2 WBPaper00052884:emb-4(hc60)_upregulated
  Transcripts that showed significantly increased expression in sma-2(rax5) comparing to in N2 at 1-day post-L4 adult hermaphrodite HTseq-count was used to count reads mapped to each gene and counting data was imported to EdgeR for statistical analysis. Statistical significance was defined by adjusted P value (false discovery rate, FDR) of <0.05. WBPaper00053184:sma-2(rax5)_upregulated
  Genes upregulated in sma-2 L4 (3 arrays) or sma-4 L4 (1 array) vs. N2 L4. FDR = 0%, SAM. WBPaper00037682:sma-2_sma-4_upregulated
  Transcripts that showed significantly decreased expression in let-767(RNAi) L4 animals comparing to animals fed with empty vector. log2 fold change > 1.5 or < -1.5, p-value < 0.05 WBPaper00066679:let-767(RNAi)_downregulated
  Genes depleted in muscle cells (24hr muscle dataset). Dissociated myo-3::GFP embryos were cultured for 24 hours before FACS sorting. A two-class unpaired analysis was performed to identify genes that are elevated 1.7-fold or greater when compared with the reference for each dataset, at a false discovery rate of 1.8% or less for M0 and 1.2% or less for the M24 datasets. WBPaper00031003:24hr_muscle_depleted
  Total muscle depleted genes (complete list of non-overlapping genes from the 0hr and 24hr muscle depleted datasets). A two-class unpaired analysis was performed to identify genes that are elevated 1.7-fold or greater when compared with the reference for each dataset, at a false discovery rate of 1.8% or less for M0 and 1.2% or less for the M24 datasets. WBPaper00031003:total_muscle_depleted
  Significantly downregulated genes from cyc-1(RNAi) microarrays using SAM algorithm with an FDR < 0.1 from adult-only chips. SAM algorithm with an FDR < 0.1. WBPaper00033065:cyc-1(RNAi)_downregulated
  Genes with increased expression in tbx-2(bx59) comparing to N2. The limma package was used to calculate differential expression using the limma linear model fit, eBayes smoothing of standard errors, and Benjamini-hochberg(Bh) multiple test correction with a false discovery rate of 5%. WBPaper00042274:tbx-2(bx59)_upregulated

12 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Also expressed in (comments from author) : Embryo incomplete. To be updated. Strain: BC12431 [oig-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGTTATTCCTTCTCCTGTTCCAA] 3' and primer B 5' [ACTCGGAGAAGATAGTCGAACG] 3'. Expr5217 Adult Expression: Nervous System; nerve ring; ventral nerve cord; Larval Expression: Nervous System; nerve ring; ventral nerve cord;  
    Expr10605 Expressed in D neurons of the L1 ventral cord with additional neuronal expression elsewhere.  
    Expr15399    
Reference: personal communication from Oliver Hobert 2002-12-07.   Expr1755 Neuronal expression in: 4-6 cells in RVG; several classes of VNC-MNs; 4 labial sensory neurons Neuronal expression in: 4-6 cells in RVG; several classes of VNC-MNs; 4 labial sensory neurons.  
    Expr12423 Transgenic animals carrying an oig-1 fosmid-based reporter construct showed expression both in the DD and VD motor neurons (MN), but no other ventral nerve cord MNs. Notably, expression of oig-1 in the D-type MNs is temporally controlled in a manner that correlates with the distinct periods of inhibition of dorsal muscle innervation exhibited by DD and VD neurons. oig-1 is transiently expressed in the DD neurons during the time when no dorsal synapses are formed (embryos and L1), but is downregulated in the DD neurons upon formation of their dorsal synapses (L2 and later). In contrast, expression of oig-1 in the VD neurons, which have processes but no synaptic outputs in the dorsal cord, is continuously maintained throughout the life of the neuron.  
    Expr12467 Poig-1::GFP is expressed in DD motor neurons in early L1 larvae. As development proceeds, the Poig-1::GFP signal declines in DD motor neurons but shows strong expression in VD motor neurons beginning soon after their birth at the end of the L1 stage. Poig-1::GFP is also expressed in a subset of head neurons.  
Original chronogram file: chronogram.1978.xml [C09E7.3:gfp] transcriptional fusion. Chronogram931    
    Expr1023475 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
    Expr12424   Co-labelling with the presynaptic RIM protein UNC-10 and the postsynaptic GABA receptor UNC-49 demonstrates that these puncta correspond to the perisynaptic region of synapses that D-type MNs form onto ventral muscle. Punctate OIG-1 protein is also observed in a few head neurons.
    Expr1144262 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  
    Expr2032851 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr2014618 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  

9 GO Annotation

Annotation Extension Qualifier
  located_in
  located_in
  located_in
  located_in
  located_in
  located_in
  located_in
occurs_in(WBbt:0005270) involved_in
  involved_in

0 Homologues

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00003859 6524051 6525657 -1

9 Ontology Annotations

Annotation Extension Qualifier
  located_in
  located_in
  located_in
  located_in
  located_in
  located_in
  located_in
occurs_in(WBbt:0005270) involved_in
  involved_in

0 Regulates Expr Cluster

1 Sequence

Length
1607

1 Sequence Ontology Term

Identifier Name Description
gene  

5 Strains

WormBase ID
WBStrain00036436
WBStrain00037716
WBStrain00047363
WBStrain00047365
WBStrain00002148

1 Upstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrIII_6525658..6528201   2544 III: 6525658-6528201 Caenorhabditis elegans