|
No detailed description on expression patterns in other life stages or other tissue. |
|
Expr4404
|
A pha-4::gfp::pha-4 3'UTR transgene is highly expressed in the intestinal cells of early stage (L3) larvae but is only weakly visible in L4 and adult animals. |
|
|
|
|
Expr4602
|
Using a red fluorescent protein (RFP) transcriptional fusion to the pha-4 promoter, strong expression was observed in the developing pharynx and in the intestine. In the adult animal, expression was lacking in the pharynx, but still present in the intestine. |
|
|
|
|
Expr4603
|
Using a full-length pha-4 complementary DNA translation fusion to GFP under the pha-4 promoter, nuclear localization of PHA-4 was observed during development and adulthood in the developing pharynx and in the intestines and also found in the adult worm in a few neuronal cells in the head and tail, which were not found in the developing animal. This expression pattern did not change in response to dietary restriction, and PHA-4 seemed constitutively nuclear under all conditions tested. |
Nuclear expression. |
|
|
|
Expr1031920
|
Tiling arrays expression graphs |
|
|
Strain: BC11059 |
[pha-4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTCGATTTGTTCTCCCTTTGTA] 3' and primer B 5' [GGCGATGTCATTGTATCTCAAA] 3'. |
Expr5992
|
Adult Expression: intestine; Larval Expression: intestine; |
|
|
|
|
Expr1019345
|
Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
|
|
|
|
Expr1431
|
In six comma-stage embryos, an average of 80.5 ( 2.5 s.d.) PHA-4-staining pharyngeal nuclei were counted by confocal microscopy (maximum count = 85). Analysis of later stage animals shows clearly that all six cells of the pharyngeal-intestinal valve contain PHA-4 protein. Thus the total number of potentially staining nuclei (pharynx + valve) should be equal to 86. all cells of the pharyngeal primordium (+ valve) contain the nuclear factor PHA-4. The same embryos also show nuclear PHA-4 in 6-8 rectal cells, including the two rectal valve cells and the three rectal epithelial cells. At the lima bean and comma stages of embryogenesis, a low but significant level of PHA-4 can be detected in the gut. pha-4 gene is expressed in pharyngeal precursor cells well before the formation of the pharynx primordium. PHA-4 can be detected immunologically in most but not all nuclei of the larval and adult pharynx. PHA-4 is detected in nuclei of all epithelial cells, muscle cells, marginal cells, gland cells and pharyngeal intestinal valve cells, but is detected only in about 8 of 19 neuronal nuclei. PHA-4 is also detected in one (comma stage) to several (pretzel stage and later) head cells outside of the pharynx. PHA-4 can also be detected in nuclei of the developing somatic gonad, including the distal tip cell and ventral uterine cells. |
nuclear |
|
Temporal description |
|
Expr11543
|
PHA-4 varies over development: At embryonic, L1, and L2 stages it is highly expressed in pharynx, head, and tail neurons,with weaker intestinal expression; while in adults, PHA-4 becomes detectable in the somatic gonad, weaker in the pharynx, and stronger in intestinal cells; moreover, in some cells, PHA-4 is not nuclear at this stage. |
|
|
|
|
Expr15866
|
PHA-4:GFP:3xFLAG transgenic animals bearing an integrated transgene had nuclear-localized expression in the pharynx and intestine in embryos, and in pharynx, intestine and rectum in larvae, confirming published expression patterns. |
|
|
|
|
Expr1200129
|
Data from the TransgeneOme project |
|
|
For in situ hybridization, the signal from anti-sense probes was abolished by ribonuclease treatment of embryos. cDNA clone used as template for unidirectional PCR began at position 14 and ended at 2033 to remove the poly-A tract. For reporter gene, integrant gave same results, confirming that mosaicism. was not responsible for pattern. Reporter gene results gave resolution of cells. Transgenic Marker: rol-6(su1006). Reporter gene and in situ hybridization gave similar results, but lacZ expression was more intense in gut than pharynx. Hybridization results differed in being more intense in pharynx. early embryo(author) = late cleavage stage embryo(curator). late embryo(author) = comma + 1.5-fold + 2-fold + 3-fold + fully-elongated embryo(curator). |
|
Expr509
|
In the gut at the 8E cell stage; E descendants continue to show expression through late embryo. Pharyngeal cells derived from both AB and MS lineages show staining starting at comma stage. Intestinal and pharyngeal staining decline after hatching. The developing somatic gonad shows expression at L3 and L4. In comma to 1.5-fold stage embryos, hybridization was also seen in the tail region. |
|
|
|
|
Expr8164
|
Expressed in intestine: Exxx (20 intestine cells). Onset time: <200 cells. Expressed in pharynx: ABalpaxxx, ABaraaxxx, ABarapaxxx (57 pharyngeal cells, 4 neurons, 4 hypodermal cells). MSaaxxx, MSpaxxx (37 pharyngeal cells, 2 neurons, 10 muscle cells). Onset time: <200 cells. Expressed in rectal precursors: ABprpapppxx, ABprpppppax, ABplpppppax, ABplpapppxx (7 rectal and digestive muscle cells, 2 neurons, 1 muscle cell.) Onset time: >350 cells. |
|
|
|
|
Expr1150554
|
Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015 |
|
|
Picture: Figure 1. |
|
Expr8143
|
pha-4 transcripts were much more abundant in the dauer stage than in mixed stages, and were also detected shortly after dauer larvae started to recover. pha-4 transcripts decreased during resumption of development. |
|
|
No detailed description on postembryonic expression pattern. |
|
Expr1419
|
PHA-4 was observed in the nuclei of cells destined to form the digestive tract. At the 4E stage, weak expression is detected in 8 MS great-granddaughters and 10 ABa descendants (ABaraaaa/p, ABaraapa/p, ABarapaa/p, ABalpaaa/p, ABalpapa/p) that each produce pharyngeal cells, as well as nonpharyngeal cells. Faint expression was also detected in the four midgut precursors. Brighter staining is observed in 6 to 8 MS-derived and 16 to 18 ABa-derived cells after the next cell division (MSaaaa/p, MSaapa/p, MSpaaa/p, MSpapa/p). Soon thereafter, at the 8 to 12E stage, PHA-4 is first observed in the rectal precursors. Expression is maintained in all pharyngeal, midgut, and rectal cells throughout embryogenesis. |
nuclei |
|
|
|
Expr14874
|
pha-4 expression was detected in the nuclei of the intestine, pharynx and arcade cells, both in the nxf-1(t2160ts) mutant and WT. All nine arcade nuclei could be identified and were located approximately between the pharyngeal and epidermal cells. |
|
|
|
|
Expr13733
|
PHA-4::GFP is also expressed in the nucleolus of intestine cells. |
|
|
|
|
Expr10413
|
Inferred Expression. EPIC dataset. http://epic.gs.washington.edu/ Large-scale cellular resolution compendium of gene expression dynamics throughout development. This reporter was inferred to be expressing in this cell or one of its embryonic progenitor cells as described below. To generate a compact description of which cells express a particular reporter irrespective of time, the authors defined a metric "peak expression" for each of the 671 terminal ("leaf") cells born during embryogenesis. For each of these cells, the peak expression is the maximal reporter intensity observed in that cell or any of its ancestors; this has the effect of transposing earlier expression forward in time to the terminal set of cells. This metric allows straightforward comparisons of genes' cellular and lineal expression overlap, even when the expression occurs with different timing and despite differences in the precise time point that curation ended in different movies, at the cost of ignoring the temporal dynamics of expression, a topic that requires separate treatment. For simplicity, the authors use the term "expressing cells" to mean the number of leaf cells (of 671) with peak expression greater than background (2000 intensity units) and at least 10% of the maximum expression in that embryo. Quantitative expression data for all cells are located here: ftp://caltech.wormbase.org/pub/wormbase/datasets-published/murray2012/ |
|
|
|
|
Expr10415
|
Inferred Expression. EPIC dataset. http://epic.gs.washington.edu/ Large-scale cellular resolution compendium of gene expression dynamics throughout development. This reporter was inferred to be expressing in this cell or one of its embryonic progenitor cells as described below. To generate a compact description of which cells express a particular reporter irrespective of time, the authors defined a metric "peak expression" for each of the 671 terminal ("leaf") cells born during embryogenesis. For each of these cells, the peak expression is the maximal reporter intensity observed in that cell or any of its ancestors; this has the effect of transposing earlier expression forward in time to the terminal set of cells. This metric allows straightforward comparisons of genes' cellular and lineal expression overlap, even when the expression occurs with different timing and despite differences in the precise time point that curation ended in different movies, at the cost of ignoring the temporal dynamics of expression, a topic that requires separate treatment. For simplicity, the authors use the term "expressing cells" to mean the number of leaf cells (of 671) with peak expression greater than background (2000 intensity units) and at least 10% of the maximum expression in that embryo. Quantitative expression data for all cells are located here: ftp://caltech.wormbase.org/pub/wormbase/datasets-published/murray2012/ |
|
|
|
|
Expr10418
|
Inferred Expression. EPIC dataset. http://epic.gs.washington.edu/ Large-scale cellular resolution compendium of gene expression dynamics throughout development. This reporter was inferred to be expressing in this cell or one of its embryonic progenitor cells as described below. To generate a compact description of which cells express a particular reporter irrespective of time, the authors defined a metric "peak expression" for each of the 671 terminal ("leaf") cells born during embryogenesis. For each of these cells, the peak expression is the maximal reporter intensity observed in that cell or any of its ancestors; this has the effect of transposing earlier expression forward in time to the terminal set of cells. This metric allows straightforward comparisons of genes' cellular and lineal expression overlap, even when the expression occurs with different timing and despite differences in the precise time point that curation ended in different movies, at the cost of ignoring the temporal dynamics of expression, a topic that requires separate treatment. For simplicity, the authors use the term "expressing cells" to mean the number of leaf cells (of 671) with peak expression greater than background (2000 intensity units) and at least 10% of the maximum expression in that embryo. Quantitative expression data for all cells are located here: ftp://caltech.wormbase.org/pub/wormbase/datasets-published/murray2012/ |
|
|
|
|
Expr10417
|
Inferred Expression. EPIC dataset. http://epic.gs.washington.edu/ Large-scale cellular resolution compendium of gene expression dynamics throughout development. This reporter was inferred to be expressing in this cell or one of its embryonic progenitor cells as described below. To generate a compact description of which cells express a particular reporter irrespective of time, the authors defined a metric "peak expression" for each of the 671 terminal ("leaf") cells born during embryogenesis. For each of these cells, the peak expression is the maximal reporter intensity observed in that cell or any of its ancestors; this has the effect of transposing earlier expression forward in time to the terminal set of cells. This metric allows straightforward comparisons of genes' cellular and lineal expression overlap, even when the expression occurs with different timing and despite differences in the precise time point that curation ended in different movies, at the cost of ignoring the temporal dynamics of expression, a topic that requires separate treatment. For simplicity, the authors use the term "expressing cells" to mean the number of leaf cells (of 671) with peak expression greater than background (2000 intensity units) and at least 10% of the maximum expression in that embryo. Quantitative expression data for all cells are located here: ftp://caltech.wormbase.org/pub/wormbase/datasets-published/murray2012/ |
|
|
|
|
Expr10419
|
Inferred Expression. EPIC dataset. http://epic.gs.washington.edu/ Large-scale cellular resolution compendium of gene expression dynamics throughout development. This reporter was inferred to be expressing in this cell or one of its embryonic progenitor cells as described below. To generate a compact description of which cells express a particular reporter irrespective of time, the authors defined a metric "peak expression" for each of the 671 terminal ("leaf") cells born during embryogenesis. For each of these cells, the peak expression is the maximal reporter intensity observed in that cell or any of its ancestors; this has the effect of transposing earlier expression forward in time to the terminal set of cells. This metric allows straightforward comparisons of genes' cellular and lineal expression overlap, even when the expression occurs with different timing and despite differences in the precise time point that curation ended in different movies, at the cost of ignoring the temporal dynamics of expression, a topic that requires separate treatment. For simplicity, the authors use the term "expressing cells" to mean the number of leaf cells (of 671) with peak expression greater than background (2000 intensity units) and at least 10% of the maximum expression in that embryo. Quantitative expression data for all cells are located here: ftp://caltech.wormbase.org/pub/wormbase/datasets-published/murray2012/ |
|
|
|
|
Expr10420
|
Inferred Expression. EPIC dataset. http://epic.gs.washington.edu/ Large-scale cellular resolution compendium of gene expression dynamics throughout development. This reporter was inferred to be expressing in this cell or one of its embryonic progenitor cells as described below. To generate a compact description of which cells express a particular reporter irrespective of time, the authors defined a metric "peak expression" for each of the 671 terminal ("leaf") cells born during embryogenesis. For each of these cells, the peak expression is the maximal reporter intensity observed in that cell or any of its ancestors; this has the effect of transposing earlier expression forward in time to the terminal set of cells. This metric allows straightforward comparisons of genes' cellular and lineal expression overlap, even when the expression occurs with different timing and despite differences in the precise time point that curation ended in different movies, at the cost of ignoring the temporal dynamics of expression, a topic that requires separate treatment. For simplicity, the authors use the term "expressing cells" to mean the number of leaf cells (of 671) with peak expression greater than background (2000 intensity units) and at least 10% of the maximum expression in that embryo. Quantitative expression data for all cells are located here: ftp://caltech.wormbase.org/pub/wormbase/datasets-published/murray2012/ |
|
|
|
|
Expr10519
|
Inferred Expression. EPIC dataset. http://epic.gs.washington.edu/ Large-scale cellular resolution compendium of gene expression dynamics throughout development. This reporter was inferred to be expressing in this cell or one of its embryonic progenitor cells as described below. To generate a compact description of which cells express a particular reporter irrespective of time, the authors defined a metric "peak expression" for each of the 671 terminal ("leaf") cells born during embryogenesis. For each of these cells, the peak expression is the maximal reporter intensity observed in that cell or any of its ancestors; this has the effect of transposing earlier expression forward in time to the terminal set of cells. This metric allows straightforward comparisons of genes' cellular and lineal expression overlap, even when the expression occurs with different timing and despite differences in the precise time point that curation ended in different movies, at the cost of ignoring the temporal dynamics of expression, a topic that requires separate treatment. For simplicity, the authors use the term "expressing cells" to mean the number of leaf cells (of 671) with peak expression greater than background (2000 intensity units) and at least 10% of the maximum expression in that embryo. Quantitative expression data for all cells are located here: ftp://caltech.wormbase.org/pub/wormbase/datasets-published/murray2012/ |
|
|
|
|
Expr10524
|
Inferred Expression. EPIC dataset. http://epic.gs.washington.edu/ Large-scale cellular resolution compendium of gene expression dynamics throughout development. This reporter was inferred to be expressing in this cell or one of its embryonic progenitor cells as described below. To generate a compact description of which cells express a particular reporter irrespective of time, the authors defined a metric "peak expression" for each of the 671 terminal ("leaf") cells born during embryogenesis. For each of these cells, the peak expression is the maximal reporter intensity observed in that cell or any of its ancestors; this has the effect of transposing earlier expression forward in time to the terminal set of cells. This metric allows straightforward comparisons of genes' cellular and lineal expression overlap, even when the expression occurs with different timing and despite differences in the precise time point that curation ended in different movies, at the cost of ignoring the temporal dynamics of expression, a topic that requires separate treatment. For simplicity, the authors use the term "expressing cells" to mean the number of leaf cells (of 671) with peak expression greater than background (2000 intensity units) and at least 10% of the maximum expression in that embryo. Quantitative expression data for all cells are located here: ftp://caltech.wormbase.org/pub/wormbase/datasets-published/murray2012/ |
|
|
|
|
Expr10518
|
Inferred Expression. EPIC dataset. http://epic.gs.washington.edu/ Large-scale cellular resolution compendium of gene expression dynamics throughout development. This reporter was inferred to be expressing in this cell or one of its embryonic progenitor cells as described below. To generate a compact description of which cells express a particular reporter irrespective of time, the authors defined a metric "peak expression" for each of the 671 terminal ("leaf") cells born during embryogenesis. For each of these cells, the peak expression is the maximal reporter intensity observed in that cell or any of its ancestors; this has the effect of transposing earlier expression forward in time to the terminal set of cells. This metric allows straightforward comparisons of genes' cellular and lineal expression overlap, even when the expression occurs with different timing and despite differences in the precise time point that curation ended in different movies, at the cost of ignoring the temporal dynamics of expression, a topic that requires separate treatment. For simplicity, the authors use the term "expressing cells" to mean the number of leaf cells (of 671) with peak expression greater than background (2000 intensity units) and at least 10% of the maximum expression in that embryo. Quantitative expression data for all cells are located here: ftp://caltech.wormbase.org/pub/wormbase/datasets-published/murray2012/ |
|
|
|
|
Expr10523
|
Inferred Expression. EPIC dataset. http://epic.gs.washington.edu/ Large-scale cellular resolution compendium of gene expression dynamics throughout development. This reporter was inferred to be expressing in this cell or one of its embryonic progenitor cells as described below. To generate a compact description of which cells express a particular reporter irrespective of time, the authors defined a metric "peak expression" for each of the 671 terminal ("leaf") cells born during embryogenesis. For each of these cells, the peak expression is the maximal reporter intensity observed in that cell or any of its ancestors; this has the effect of transposing earlier expression forward in time to the terminal set of cells. This metric allows straightforward comparisons of genes' cellular and lineal expression overlap, even when the expression occurs with different timing and despite differences in the precise time point that curation ended in different movies, at the cost of ignoring the temporal dynamics of expression, a topic that requires separate treatment. For simplicity, the authors use the term "expressing cells" to mean the number of leaf cells (of 671) with peak expression greater than background (2000 intensity units) and at least 10% of the maximum expression in that embryo. Quantitative expression data for all cells are located here: ftp://caltech.wormbase.org/pub/wormbase/datasets-published/murray2012/ |
|
|
|
|
Expr10520
|
Inferred Expression. EPIC dataset. http://epic.gs.washington.edu/ Large-scale cellular resolution compendium of gene expression dynamics throughout development. This reporter was inferred to be expressing in this cell or one of its embryonic progenitor cells as described below. To generate a compact description of which cells express a particular reporter irrespective of time, the authors defined a metric "peak expression" for each of the 671 terminal ("leaf") cells born during embryogenesis. For each of these cells, the peak expression is the maximal reporter intensity observed in that cell or any of its ancestors; this has the effect of transposing earlier expression forward in time to the terminal set of cells. This metric allows straightforward comparisons of genes' cellular and lineal expression overlap, even when the expression occurs with different timing and despite differences in the precise time point that curation ended in different movies, at the cost of ignoring the temporal dynamics of expression, a topic that requires separate treatment. For simplicity, the authors use the term "expressing cells" to mean the number of leaf cells (of 671) with peak expression greater than background (2000 intensity units) and at least 10% of the maximum expression in that embryo. Quantitative expression data for all cells are located here: ftp://caltech.wormbase.org/pub/wormbase/datasets-published/murray2012/ |
|
|
|
|
Expr10522
|
Inferred Expression. EPIC dataset. http://epic.gs.washington.edu/ Large-scale cellular resolution compendium of gene expression dynamics throughout development. This reporter was inferred to be expressing in this cell or one of its embryonic progenitor cells as described below. To generate a compact description of which cells express a particular reporter irrespective of time, the authors defined a metric "peak expression" for each of the 671 terminal ("leaf") cells born during embryogenesis. For each of these cells, the peak expression is the maximal reporter intensity observed in that cell or any of its ancestors; this has the effect of transposing earlier expression forward in time to the terminal set of cells. This metric allows straightforward comparisons of genes' cellular and lineal expression overlap, even when the expression occurs with different timing and despite differences in the precise time point that curation ended in different movies, at the cost of ignoring the temporal dynamics of expression, a topic that requires separate treatment. For simplicity, the authors use the term "expressing cells" to mean the number of leaf cells (of 671) with peak expression greater than background (2000 intensity units) and at least 10% of the maximum expression in that embryo. Quantitative expression data for all cells are located here: ftp://caltech.wormbase.org/pub/wormbase/datasets-published/murray2012/ |
|
|
|
|
Expr10412
|
Inferred Expression. EPIC dataset. http://epic.gs.washington.edu/ Large-scale cellular resolution compendium of gene expression dynamics throughout development. This reporter was inferred to be expressing in this cell or one of its embryonic progenitor cells as described below. To generate a compact description of which cells express a particular reporter irrespective of time, the authors defined a metric "peak expression" for each of the 671 terminal ("leaf") cells born during embryogenesis. For each of these cells, the peak expression is the maximal reporter intensity observed in that cell or any of its ancestors; this has the effect of transposing earlier expression forward in time to the terminal set of cells. This metric allows straightforward comparisons of genes' cellular and lineal expression overlap, even when the expression occurs with different timing and despite differences in the precise time point that curation ended in different movies, at the cost of ignoring the temporal dynamics of expression, a topic that requires separate treatment. For simplicity, the authors use the term "expressing cells" to mean the number of leaf cells (of 671) with peak expression greater than background (2000 intensity units) and at least 10% of the maximum expression in that embryo. Quantitative expression data for all cells are located here: ftp://caltech.wormbase.org/pub/wormbase/datasets-published/murray2012/ |
|
