WormMine: Gene WBGene00004134

• WormBase Gene ID: WBGene00004134
• Gene Name: myrf-1
• Sequence Name: F59B10.1
• Brief Description: myrf-1 encodes a protein with a glutamine/asparagine-rich domain, orthologous to human MYRF (myelin regulatory factor); in C. elegans, MYRF-1 activity is required for regulation of the molting cycle, specifically the completion of larval molts and cessation of molting in reproductively mature adult animals; a MYRF-1::GFP fusion protein is expressed in a wide variety of cells and tissues, including neurons, secretory cells, and hypodermal seam cells, but is not seen in the hyp7 syncytial hypodermis; expression begins in the comma stage of embryogenesis and persists through adulthood; full length C. elegans MYRF-1::GFP localizes to the cytoplasm where it partially overlaps with the endoplasmic reticulum; MYRF-1 contains a well-conserved paralog in the C. elegans genome, MYRF-2, encoded by F21A10.2.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable DNA-binding transcription factor activity and sequence-specific DNA binding activity. Involved in ecdysis, collagen and cuticulin-based cuticle and nematode larval development. Located in basal part of cell and endoplasmic reticulum. Expressed in several structures, including ciliated neurons; excretory duct; gonad; pharyngeal cell; and somatic nervous system. Human ortholog(s) of this gene implicated in cerebral infarction; congenital diaphragmatic hernia; and eye disease (multiple). Is an ortholog of human MYRFL (myelin regulatory factor like).
• Biotype: SO:0001217
• Genetic Position: II :2.9838 ±0.041984
• Length (nt): 5555

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00004134

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:F59B10.1.1	F59B10.1.1	3654	II: 10496987-10502541

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:F59B10.1	F59B10.1	2796	II: 10497791-10497810

46 RNAi Result

• WBRNAi00095655
• WBRNAi00049135
• WBRNAi00008905
• WBRNAi00025767
• WBRNAi00007508
• WBRNAi00062793
• WBRNAi00096844
• WBRNAi00092934
• WBRNAi00095882
• WBRNAi00095959
• WBRNAi00096034
• WBRNAi00096111
• WBRNAi00096188
• WBRNAi00096265
• WBRNAi00096358
• WBRNAi00096441
• WBRNAi00096524
• WBRNAi00096623
• WBRNAi00107236
• WBRNAi00105788
• WBRNAi00105782
• WBRNAi00105781
• WBRNAi00105784
• WBRNAi00105783
• WBRNAi00105786
• WBRNAi00105785
• WBRNAi00105787
• WBRNAi00105790
• WBRNAi00105789
• WBRNAi00105792

84 Allele

• gk963801
• gk963053
• gk962682
• WBVar02120634
• WBVar02122438
• WBVar01604724
• WBVar01604725
• WBVar01546786
• WBVar01378412
• WBVar01935427
• gk153031
• gk2548
• gk153028
• gk153027
• gk153030
• gk153029
• ok5593
• mg412
• WBVar01243972
• ju1121
• WBVar01784451
• WBVar00175135
• gk3366
• ybq14
• ybq6
• ybq7
• WBVar01943471
• WBVar00228414
• WBVar00228413
• WBVar00228412

1 Chromosome

• WormBase ID: II
• Organism: Caenorhabditis elegans
• Length (nt): 15279421

1 Chromosome Location

• Feature . Primary Identifier: WBGene00004134
• Start: 10496987
• End: 10502541
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrII_10496704..10496986
• Length (nt): 283
• Chromosome Location: II: 10496704-10496986
• Organism: Caenorhabditis elegans

192 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:all-neurons_L1-larva_expressed
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when no food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_NoFood
	Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin_upregulated
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts that showed significantly decreased expression in atfs-1(cmh15) (null allele) animals comparing to in N2 animals at L4 larva stage.	edgeR, fold change > 2, FDR < 0.05	WBPaper00060909:atfs-1(cmh15)_downregulated
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
	Genes with expression level regulated by genotype (N2 vs CB4856) at L3 larva and Late reproduction stage (96 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_regulated_developing
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_daf-16(mu86);glp-1(e2141)
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141)
Bacteria infection: Bacillus thuringiensis	Transcripts that showed significantly increased expression in N2 animals infected by bacteria BMB171/Cry5Ba, an acrystalliferous Bt mutant BMB171 transformed with toxin gene cry5Ba on the shuttle vector pHT304, comparing to N2 animals infected by BMB171/pHT304.	N.A.	WBPaper00064229:B.thuringiensis-Cry5Ba_upregulated
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_6h
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
	Transcripts that showed significantly increased expression in hrde-1(tm1200) animals, comparing to in N2, after growing at 25C for five generations (late generation).	CuffDiff2	WBPaper00051265:F4_hrde-1(tm1200)_upregulated
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage.	DESeq	WBPaper00053302:stavudine_24h_regulated
	Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	DESeq2, fold change > 2, adjusted p-value < 0.01	WBPaper00058598:sin-3(tm1276)_downregulated
	Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy.	Cufflinks	WBPaper00065120:body-muscle-transcriptome
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:A-class-motor-neurons_L2-larva_expressed

14 Expression Patterns

• Primary Identifier: Expr6262
• Remark: Also expressed in (comments from author) : No comments. Strain: BC15924
• Reporter Gene: [pqn-47::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGTTTTCTTCAAAAACCCCCA] 3' and primer B 5' [CGACATGTTCGAAGTGTGCTA] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal gland cells; intestine; rectal gland cells; anal depressor muscle; Reproductive System; uterine muscle; vulval muscle; body wall muscle; head mesodermal cell; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; Larval Expression: pharynx; pharyngeal gland cells; intestine; rectal gland cells; anal depressor muscle; Reproductive System; developing vulva; body wall muscle; head mesodermal cell; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons

• Primary Identifier: Expr9722
• Pattern: Expression becomes detectable around the comma stage of embryogenesis and persists through adulthood. Expression in vulval precursor cells is strong and can first be seen in L3. PQN-47::GFP is expressed in seam cells, peaking at L2 and ceasing after the seam cells differentiate in late L4, concurrent with the appearance of alae. The intestine shows variably undetectable to low pqn-47 expression (always less than in the neurons) and gets dimmer as development progresses, especially after L3. The two bulbs of the pharynx, specifically pharyngeal muscle cells pm3-8 (not pm6), are variably bright. Overall expression levels are lower in adults than younger animals, with only some expression in head and tail neurons remaining. Head and nerve ring neurons, pharyngeal cells, ventral nerve cord cells, vulval precursor cells, seam (though interestingly not hyp7), as well as cells in the tail show the strongest pqn-47 expression. Muscle, intestine, the distal tip cells of the gonad, the spermatheca, and a large neuron that may be CAN that is essential for survival but of unknown function near the vulva (also bathed in pseudocoelom fluid, and next to the seam and canal cells), as well as a subset of the ciliated neurons of the head (amphid neurons ASI, ADL, ASK, or AWB) and tail including phasmid cilia PHA and PHB, also express pqn-47. We could not detect expression in the pharyngeal glands as reported for a different promoter pqn-47 fusion construct made as part of a high-throughput analysis of gene expression, although other tissues did show similar patterns. Promoter and translational reporters show pqn-47 expression in numerous somatic cells, including cells uniquely poised to mediate or transmit signal(s) involved in the regulation of molting, some of which have been implicated in molting. For example, many cells expressing PQN-47 have significant exposure to the pseudocoelom, and as such are candidates to transmit or detect endocrine signals; the H-shaped excretory cell and its ducts, which form extensive gap junctions with the hypodermis and lie against the pseudocoelom along the entire body of the worm (Nelson and Riddle, 1984), the head mesodermal cell (hmc) lies in the pseudocoelom up against the (excretory) gland cell and forms gap junctions with them and muscle, and the VPI cells at the juncture of the pharynx and intestine are bathed by the pseudocoelom, as well as the intestine itself.

• Primary Identifier: Expr15839
• Subcellular Localization: In early L1 larvae, myrf-1GFP signal was observed at the cell membrane of many cell types, including pharynx, epidermis, and neurons, but were not obviously enriched in the cytoplasm or nucleus. Toward late L1 stage, GFP signals started to appear in the nucleus.

• Primary Identifier: Expr1032009
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr13354
• Pattern: myrf-1 was expressed in DDs at late L1 and continued to express in DDs in the L2 stage. The upregulation of MYRF-1 in ventral cord neurons at late L1 supports our hypothesis that myrf-1 plays a specific role in DD rewiring.

• Primary Identifier: Expr9723
• Subcellular Localization: The functional PQN-47::GFP protein fusion is localized to cytoplasmic and perinuclear dots. The perinuclear dots of PQN-47::GFP localization suggest endoplasmic reticulum or golgi localization. We also noticed that PQN-47::GFP expression is restricted to the basal cytoplasm in the seam cells.

• Primary Identifier: Expr11995

• Primary Identifier: Expr1152880
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Chronogram726
• Remark: Original chronogram file: chronogram.1757.xml
• Reporter Gene: [F59B10.1:gfp] transcriptional fusion.

• Primary Identifier: Expr2013846
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1011440
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr13352
• Remark: Cleaved products: N-term nucleus; C-term ER
• Subcellular Localization: N-terminal MYRF-1 (GFP tagged) localizes to the nucleus, whereas C-terminal MYRF-1 (FLAG-tagged) is present predominantly in the ER. This suggest that MYRF-1 is cleaved into N- and C-terminal fragments.

• Primary Identifier: Expr13353
• Remark: Cleaved products: N-term nucleus; C-term ER
• Subcellular Localization: N-terminal MYRF-1 (GFP tagged) localizes to the nucleus, whereas C-terminal MYRF-1 (FLAG-tagged) is present predominantly in the ER. This suggest that MYRF-1 is cleaved into N- and C-terminal fragments.

• Primary Identifier: Expr2032086
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

30 GO Annotation

7 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00004134
• Start: 10496987
• End: 10502541
• Strand: -1

30 Ontology Annotations

2 Regulates Expr Cluster

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Proteins interacting with GFP-MYRF-1.	The fil-tering criteria were: 1% FDR at both the peptide level and the protein level; precursor mass toler-ance, 20 ppm; fragment mass tolerance, 20 ppm; the peptide length, 6100 aa. To identify high-confidence candidate interacting proteins, The WD-Scores of proteins identified in each IP-MS sam-ple were calculated against the identification results of 71 unrelated IP-MS samples, according tothe formulas from the CompPASS tutorial.	WBPaper00061377:MYRF-1_interacting
	microRNAs that showed significantly altered expression in myrf-1(ju1121) comparing to in control animals.	DESeq2, FDR < 0.05.	WBPaper00066953:myrf-1(ju1121)_regulated_miRNA

1 Sequence

• Length: 5555

1 Sequence Ontology Term

• Name: gene

2 Strains

• WBStrain00037768
• WBStrain00037532

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrII_10502542..10502651
• Length (nt): 110
• Chromosome Location: II: 10502542-10502651
• Organism: Caenorhabditis elegans