WormMine: Gene WBGene00004700

• WormBase Gene ID: WBGene00004700
• Gene Name: rsp-3
• Sequence Name: Y111B2A.18
• Brief Description: rsp-3 encodes an ortholog of human SF2/ASF and member of the SR protein family of nuclear phosphoproteins that are required for constitutive splicing and influence alternative splicing regulation; rsp-3 affects the development of oocytes together with rsr-1, and is required for late embryonic viability; SPK-1 binds directly to and phosphorylates the RS domain of RSP-3 in vitro; the rsp-3 mRNA is predominantly expressed in the germline.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable RNA binding activity. Involved in embryo development. Predicted to be located in nuclear speck. Expressed in PVDL; PVDR; and gonad. Human ortholog(s) of this gene implicated in several diseases, including gastrointestinal system cancer (multiple); lung non-small cell carcinoma (multiple); and urinary system cancer (multiple). Is an ortholog of human SRSF1 (serine and arginine rich splicing factor 1).
• Biotype: SO:0001217
• Genetic Position: III :18.1911 ±0.01351
• Length (nt): 1741

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00004700

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:Y111B2A.18.2	Y111B2A.18.2	1336	III: 12686182-12687922
Transcript:Y111B2A.18.1	Y111B2A.18.1	1103	III: 12686701-12687916

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:Y111B2A.18	Y111B2A.18	777	III: 12687017-12687235

22 RNAi Result

• WBRNAi00075669
• WBRNAi00075668
• WBRNAi00009285
• WBRNAi00055349
• WBRNAi00055350
• WBRNAi00055351
• WBRNAi00075320
• WBRNAi00007098
• WBRNAi00071379
• WBRNAi00075321
• WBRNAi00036572
• WBRNAi00083642
• WBRNAi00083744
• WBRNAi00083837
• WBRNAi00026590
• WBRNAi00080100
• WBRNAi00080182
• WBRNAi00066406
• WBRNAi00066324
• WBRNAi00066323
• WBRNAi00066405
• WBRNAi00069870

40 Allele

• otn9910
• gk963887
• gk188885
• gk188886
• gk188888
• gk188887
• gk188890
• gk188889
• gk188892
• gk188891
• WBVar00181961
• ok2927
• WBVar01793625
• gk656222
• WBVar01402201
• WBVar01963931
• gk859144
• gk639329
• gk484385
• WBVar01449533
• gk526788
• gk879138
• gk930414
• WBVar01273537
• gk597412
• gk837029
• gk630233
• gk656799
• gk373535
• gk480942

1 Chromosome

• WormBase ID: III
• Organism: Caenorhabditis elegans
• Length (nt): 13783801

1 Chromosome Location

• Feature . Primary Identifier: WBGene00004700
• Start: 12686182
• End: 12687922
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

0 Downstream Intergenic Region

172 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	oocyte proteins identified by two or more unique peptides during proteomics study.	In the pooled data set, 1453 C. elegans proteins were identified with a probability >= 0.9 according to ProteinProphet, of which 1165 proteins were identified by more than one unique peptide.	WBPaper00038289:oocyte_protein
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
	Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin-Allantoin_upregulated
Bacteria infection: Enterococcus faecalis OG1RF. Exposure for 16 hours.	Transcripts that showed significantly decreased expression in N2 after animals were exposed to E. faecalis OG1RF for 16 hours comparing to exposure to E. Coli OP50.	Cuffcompare and Cuffdiff	WBPaper00056090:E.faecalis_downregulated_N2
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Genes significantly enriched in NSM neurons (isolated by FACS) versus the reference, according to RNAseq analysis towards total RNA.	Gene expression quantification and differential expression was analyzed using cufflinks v2.2.1. Enriched contains only genes significantly enriched (differentially expressed >= 2.4 fold in total RNA or >= 3.2 fold in DSN treated total RNA) in the NSM neurons versus the reference.	WBPaper00045974:NSM_enriched_totalRNA_RNAseq
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_daf-16(mu86);glp-1(e2141)
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141)
Bacteria diet: Escherichia coli HB101. Fed for 30 generations.	Transcripts that showed significantly decreased expression after fed by bacteria E. coli HB101 for 30 generations comparing to animals fed by E. coli OP50.	DESeq2 fold change > 2, p-value < 0.01.	WBPaper00061007:HB101_downregulated
Bacteria diet: Sphingomonas aquatilis Yellow. Fed for 30 generations.	Transcripts that showed significantly decreased expression after fed by bacteria Sphingomonas aquatilis (Yellow) for 30 generations comparing to animals fed by E. coli OP50.	DESeq2 fold change > 2, p-value < 0.01.	WBPaper00061007:S.aquatilis_downregulated
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M
	Significantly differentially expressed genes as determined by microarray analysis of wild-type and cde-1 mutant germlines.	RNAs that changed at least 2-fold with a probability of p < 0.05 were considered differentially regulated between wildtype and cde-1.	WBPaper00035269:cde-1_regulated
Transgeneration hypoxia treatment.	Transcripts that are significantly upregulated in F1 animals after P0 parents were exposed to 0.1% oxygen for 16 hours at L4 larva stage.	For calling the significant differentially expressed genes (DEGs),the false discovery rate (FDR) after multiple testing correction was set as 0.05 and analyzed in edgeR.	WBPaper00064871:hypoxia_upregulated_F1
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage.	DESeq	WBPaper00053302:stavudine_24h_regulated
	Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy.	Cufflinks	WBPaper00065120:body-muscle-transcriptome
	Genes with increased RNA expression after 24 hours rotenone treatment	EdgeR provides statistical routines for determining differential expression in digital gene expression data using a model based on the negative binomial distribution. The resulting p-values were adjusted using the Benjamini and Hochbergs approach for controlling the false discovery rate (FDR). Transcripts with an adjusted p-value smaller 0.05 were assigned as differentially expressed.	WBPaper00044426:rotenone_24h_upregulated
Gamma irradiation 100 mGY per hour for 72 hours since L1 larva.	Transcripts that showed significantly increased expression after exposure to 100mGy per hour gamma irradiation from L1 to day 1 adult hermaphrodite stage.	DESeq2, FDR <= 0.05, log2 fold change >= 0.3 or <= -0.3.	WBPaper00058958:100mGy-irradiation-72h_upregulated

10 Expression Patterns

• Primary Identifier: Expr6885
• Remark: Also expressed in (comments from author) : No comments. Strain: BC13726
• Reporter Gene: [rsp-3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAAAACCGAAAACCACAAAAA] 3' and primer B 5' [CCACATCCGGATAGCAGAC] 3'.
• Pattern: Adult Expression: pharynx; body wall muscle; Nervous System; ventral nerve cord; head neurons; tail neurons; Larval Expression: pharynx; body wall muscle; Nervous System; ventral nerve cord; head neurons; tail neurons

• Primary Identifier: Expr6886
• Remark: Also expressed in (comments from author) : No comments. Strain: BC10506
• Reporter Gene: [rsp-3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAAAACCGAAAACCACAAAAA] 3' and primer B 5' [CCACATCCGGATAGCAGAC] 3'.
• Pattern: Adult Expression: pharynx; body wall muscle; Nervous System; head neurons; Larval Expression: pharynx; body wall muscle; Nervous System; head neurons

• Primary Identifier: Expr1032320
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr1129
• Remark: Sense probes detected no signal. Expression pattern at other life stages was not described.
• Pattern: CeSF2 hybridization signal were detected specifically in the gonad.

• Primary Identifier: Expr12217
• Pattern: rsp-3 is expressed in the PVD and broadly throughout development excluding the germ line, which often silences repetitive DNA such as the extrachromosomal arrays generated by DNA microinjection in worms.

• Primary Identifier: Expr12228
• Subcellular Localization: RSP-3 translation fusion to GFP shows clear nuclear expression.

• Primary Identifier: Expr1158880
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr2015560
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1013527
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr2033795
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

17 GO Annotation

10 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00004700
• Start: 12686182
• End: 12687922
• Strand: -1

17 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 1741

1 Sequence Ontology Term

• Name: gene

3 Strains

• WBStrain00037218
• WBStrain00001377
• WBStrain00002707

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrIII_12687923..12688317
• Length (nt): 395
• Chromosome Location: III: 12687923-12688317
• Organism: Caenorhabditis elegans