WormMine

WS296

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00004705 Gene Name  rsp-8
Sequence Name  ? C18D11.4 Brief Description  rsp-8 encodes the C. elegans ortholog of the conserved Tra2beta splicing activator.
Organism  Caenorhabditis elegans Automated Description  Predicted to enable RNA binding activity. Predicted to be involved in mRNA splicing, via spliceosome and positive regulation of mRNA splicing, via spliceosome. Predicted to be part of spliceosomal complex. Expressed in head and tail. Human ortholog(s) of this gene implicated in macular degeneration. Is an ortholog of human TRA2A (transformer 2 alpha homolog) and TRA2B (transformer 2 beta homolog).
Biotype  SO:0001217 Genetic Position  III :13.2602 ±0.003554
Length (nt)  ? 4557
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00004705

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:C18D11.4a.1 C18D11.4a.1 1189   III: 11826418-11830974
Transcript:C18D11.4b.1 C18D11.4b.1 435   III: 11829955-11830728
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:C18D11.4b C18D11.4b 435   III: 11829955-11830181
CDS:C18D11.4a C18D11.4a 930   III: 11826431-11826481

24 RNAi Result

WormBase ID
WBRNAi00073942
WBRNAi00073943
WBRNAi00073944
WBRNAi00073945
WBRNAi00073946
WBRNAi00073947
WBRNAi00073948
WBRNAi00073949
WBRNAi00040925
WBRNAi00040926
WBRNAi00024590
WBRNAi00075217
WBRNAi00075216
WBRNAi00066341
WBRNAi00072350
WBRNAi00085852
WBRNAi00029069
WBRNAi00111623
WBRNAi00072351
WBRNAi00072352
WBRNAi00002640
WBRNAi00002777
WBRNAi00008419
WBRNAi00064400

133 Allele

Public Name
gk963887
gk963147
gk964363
gk964364
gk963799
gk186991
gk186992
gk186993
gk186994
gk186995
gk186996
gk186997
gk186998
gk186999
WBVar00180581
WBVar00180580
WBVar00180578
WBVar00180579
WBVar00180576
WBVar00180577
gk944860
gk944859
gk944861
WBVar01900770
WBVar01900771
WBVar01963550
WBVar01963549
WBVar01919510
WBVar01919511
WBVar01852485

1 Chromosome

WormBase ID Organism Length (nt)
III Caenorhabditis elegans 13783801  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00004705 11826418 11830974 1

4 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  
Panther orthologue and paralogue predictions  

1 Downstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrIII_11830975..11831011   37 III: 11830975-11831011 Caenorhabditis elegans

123 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  oocyte proteins identified by two or more unique peptides during proteomics study. In the pooled data set, 1453 C. elegans proteins were identified with a probability >= 0.9 according to ProteinProphet, of which 1165 proteins were identified by more than one unique peptide. WBPaper00038289:oocyte_protein
  Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells. DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction. WBPaper00060811:L1_vs_adult_upregulated_neural
  Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. DESeq. False discovry rate (FDR) < 0.1. WBPaper00048988:neuron_expressed
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
  mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis. Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05. WBPaper00045420:fertilization_downregulated_transcript
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:AVE-neuron_L1-larva_expressed
  Proteins interacting with NHR-49-GFP according to co-IP and LC-MS. N.A. WBPaper00064071:NHR-49_interacting
  Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:arcade_intestinal-valve_expressed
  Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:GABAergic-neuron_expressed
  Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:hypodermis_expressed
  Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:NMDA-neuron_expressed
  Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:seam_expressed
  Genes with expression level regulated by genotype (N2 vs CB4856) at old adults stage (214 hours at 24 centigrade). For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR). WBPaper00040858:eQTL_regulated_aging
  Genes with expression level regulated by genotype (N2 vs CB4856) at Late reproduction stage (96 hours at 24 centigrade). Authors permuted transcript values and used a genome-wide threshold of log10 P-value = 2, which resembles a false discovery rate (FDR) of 0.0118. WBPaper00040858:eQTL_regulated_reproductive
  Transcripts detected in germline isolated from day-1 adult hermaphrodite animals. All three experiments have CPM >= 1. WBPaper00067147:germline_expressed
Transgeneration hypoxia treatment. Transcripts that are significantly upregulated in F1 animals after P0 parents were exposed to 0.1% oxygen for 16 hours at L4 larva stage. For calling the significant differentially expressed genes (DEGs),the false discovery rate (FDR) after multiple testing correction was set as 0.05 and analyzed in edgeR. WBPaper00064871:hypoxia_upregulated_F1
  Maternal class (M): genes that are called present in at least one of the three PC6 replicates. A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing. [cgc5767]:expression_class_M
  Genes with increased RNA expression after 24 hours rotenone treatment EdgeR provides statistical routines for determining differential expression in digital gene expression data using a model based on the negative binomial distribution. The resulting p-values were adjusted using the Benjamini and Hochbergs approach for controlling the false discovery rate (FDR). Transcripts with an adjusted p-value smaller 0.05 were assigned as differentially expressed. WBPaper00044426:rotenone_24h_upregulated
Gamma irradiation 100 mGY per hour for 72 hours since L1 larva. Transcripts that showed significantly increased expression after exposure to 100mGy per hour gamma irradiation from L1 to day 1 adult hermaphrodite stage. DESeq2, FDR <= 0.05, log2 fold change >= 0.3 or <= -0.3. WBPaper00058958:100mGy-irradiation-72h_upregulated
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:A-class-motor-neurons_L2-larva_expressed
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:glr-1(+)-neurons_L2-larva_expressed
  Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:PVD-OLL-neurons_L3-L4-larva_expressed
Bacteria infection: Streptococcus gordonii Transcripts that showed significantly decreased expression after L4 larva animals were exposed to wild type S. gordonii for 2-3 hours, comparing to animals exposed to S. gordonii delta-spxB. Fold change > 2, FDR corrected p-value < 0.05. WBPaper00055049:S.gordonii_downregulated
  Proteins interacting with HA-PPM-1.D. N.A. WBPaper00062498:PPM-1.D_interacting
Bacteria: B.thuringiensis Transcripts in N2 animals that were significantly differentially expressed at least for one time point and one pathogenic strain Bt247 and Bt679 compared to the non pathogenic strain Bt407. Cuffdiff WBPaper00060358:B.thuringiensis_pathogen_regulated_N2
  Genes that were not enriched in either spermatogenic fem-3(q96gf) nor oogenic fog-2(q71) gonads, according to RNAseq analysis. To identify differentially expressed transcripts, authors used R/Bioconductor package DESeq. WBPaper00045521:Gender_Neutral
  Transcripts that showed altered expression from P0 to F2 generation animals after N2 parental generation were treated with antimycin, but not in damt-1(gk961032) P0 to F2 animals after the parenal generaton were treated with antimycin. N.A. WBPaper00055862:antimycin_damt-1(gk961032)_regulated
  Transcripts that showed significantly decreased expression in nhl-2(ok818) comparing to in N2 at 25C. EdgeR, FDR < 0.05, fold change < 0.5. WBPaper00055971:nhl-2(ok818)_25C_upregulated
  Transcripts that showed decreased expression in hlh-11(ko1) knockout strain comparing to in wild type background. DESeq2, FDR < 0.05 WBPaper00060683:hlh-11(ko1)_downregulated
Bacteria infection: Enterococcus faecalis OG1RF. Exposure for 16 hours. Transcripts that showed significantly decreased expression in hpx-2(dg047) after animals were exposed to E. faecalis OG1RF for 16 hours comparing to exposure to E. Coli OP50. Cuffcompare and Cuffdiff WBPaper00056090:E.faecalis_downregulated_hpx-2(dg047)

9 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Also expressed in (comments from author) : Might have seen seam cells but we were unsure. Strain: BC12525 [rsp-8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTTTATCTGTTCCTCCGTTCAA] 3' and primer B 5' [GAACGATGGCCGATTTTG] 3'. Expr5303 Adult Expression: pharynx; stomato-intestinal muscle; Reproductive System; vulval muscle; body wall muscle; hypodermis; Nervous System; head neurons; neurons along body; unidentified cells; Larval Expression: pharynx; body wall muscle; hypodermis; Nervous System; head neurons; neurons along body; unidentified cells;  
Also expressed in (comments from author) : early embryo is only gut. Strain: DM12525 [rsp-8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTTTATCTGTTCCTCCGTTCAA] 3' and primer B 5' [GAACGATGGCCGATTTTG] 3'. Expr5304 Adult Expression: pharynx; pharyngeal-intestinal valve; stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; uterus; vulva other; gonad sheath cells; body wall muscle; seam cells; Nervous System; nerve ring; ventral nerve cord; lateral nerve cords; head neurons; tail neurons; unidentified cells in head; Larval Expression: pharynx; pharyngeal-intestinal valve; intestine; stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; developing uterus; body wall muscle; seam cells; Nervous System; nerve ring; ventral nerve cord; unidentified cells in head;  
Also expressed in (comments from author) : Unidentified cells in head and tail, possibly neural. Strain: BC10484 [rsp-8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTTTATCTGTTCCTCCGTTCAA] 3' and primer B 5' [GAACGATGGCCGATTTTG] 3'. Expr5305 Adult Expression: pharynx; intestine; stomato-intestinal muscle; anal depressor muscle; body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; intestine; stomato-intestinal muscle; anal depressor muscle; Reproductive System; developing gonad; body wall muscle; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; unidentified cells in head; unidentified cells in tail ;  
    Expr1032325 Tiling arrays expression graphs  
Original chronogram file: chronogram.1879.xml [C18D11.4:gfp] transcriptional fusion. Chronogram836    
    Expr1024517 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
    Expr2015565 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr1144971 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  
    Expr2033800 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  

9 GO Annotation

Annotation Extension Qualifier
  enables
  enables
  part_of
  involved_in
  involved_in
  enables
  enables
  enables
  enables

40 Homologues

Type
orthologue
orthologue
orthologue
least diverged orthologue
least diverged orthologue
least diverged orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00004705 11826418 11830974 1

9 Ontology Annotations

Annotation Extension Qualifier
  enables
  enables
  part_of
  involved_in
  involved_in
  enables
  enables
  enables
  enables

0 Regulates Expr Cluster

1 Sequence

Length
4557

1 Sequence Ontology Term

Identifier Name Description
gene  

3 Strains

WormBase ID
WBStrain00001370
WBStrain00006133
WBStrain00002193

1 Upstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrIII_11824976..11826417   1442 III: 11824976-11826417 Caenorhabditis elegans