WormMine: Gene WBGene00005167

• WormBase Gene ID: WBGene00005167
• Gene Name: srg-9
• Sequence Name: T12A2.10
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable transmembrane signaling receptor activity. Predicted to be involved in sensory perception of chemical stimulus. Predicted to be located in membrane. Expressed in head; neurons; and tail.
• Biotype: SO:0001217
• Genetic Position: III :-1.4076 ±6.7e-05
• Length (nt): 1317

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00005167

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:T12A2.10.1	T12A2.10.1	1011	III: 6255459-6256775

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:T12A2.10	T12A2.10	1011	III: 6255459-6255618

6 RNAi Result

• WBRNAi00053143
• WBRNAi00053144
• WBRNAi00018613
• WBRNAi00005374
• WBRNAi00035489
• WBRNAi00035490

25 Allele

• gk964518
• gk176251
• gk176252
• gk176253
• gk176254
• gk176255
• gk176257
• gk176258
• gk176259
• gk176260
• gk176256
• gk963814
• gk963815
• WBVar01264285
• WBVar01628592
• WBVar01628593
• gk476525
• gk592659
• gk885872
• gk649166
• WBVar01722601
• gk955031
• gk737157
• gk813479
• WBVar01566615

1 Chromosome

• WormBase ID: III
• Organism: Caenorhabditis elegans
• Length (nt): 13783801

1 Chromosome Location

• Feature . Primary Identifier: WBGene00005167
• Start: 6255459
• End: 6256775
• Strand: -1

3 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)

0 Downstream Intergenic Region

22 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology.	DESEQ2, fold change > 2 and FDR < 0.01.	WBPaper00062103:neuron_enriched
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Genes found to be regulated by low-copy overexpression of sir-2.1 with p < 0.014.	N.A.	WBPaper00026929:sir-2.1_overexpression_regulated
	Transcripts unqiuely expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_enriched
control(maintained under normal lab light (mostly dark, in incubators).) vs EtBr-exposed(maintained under normal lab light (mostly dark, in incubators) and exposed to EtBr (5ug/mL in agar).) at just prior to the second UVC dose (24h).	Genes differentially expressed in control vs under EtBr treatment without UVC exposure, at the -25h timepoint.	Transcripts were defined as fold-change >1.2, p < 0.05 based on Rosetta Resolver analysis for all pairwise treatment comparisons. The fold-change refers to the second intensity over the first.	WBPaper00041939:control_vs_EtBr-exposed_24h
Fungi infection: Drechmeria coniospora	Genes with decreased expression after 12 hours of infection by D.coniospora Fold changes shown are pathogen vs OP50.	For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated.	WBPaper00038438:D.coniospora_12hr_downregulated_RNAseq
	Genes upregulated by alg-1(-).	t-statistic difference of > 2.5 with p < 0.01.	WBPaper00035588:alg-1(-)_upregulated
	Genes that showed significantly increased expression level in rsr-2(RNAi) animals comparing to in gfp(RNAi) control.	Fold change > 1.2 or < 0.8.	WBPaper00042477:rsr-2(RNAi)_upregulated_TilingArray
	Transcripts that showed significantly decreased expression in spn-4(tm291) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	RPKM fold change > 2.	WBPaper00058598:spn-4(tm291)_downregulated
Bacteria infection: Serratia marcesens	Genes down-regulated in animals infected with Serratia marcesens compared to the E. coli OP50 control after 24h of infection.	MAANOVA and BRB-Array-Tools.	WBPaper00030985:Serratia_marcesens_downregulated
	Transcripts that showed significantly increased expression in drh-3(rrr2) comparing to in N2.	edgeR, log2 fold change > 2 or < -2.	WBPaper00053888:drh-3(rrr2)_upregulated
Fungi infection: Drechmeria coniospora. 24 hours of infection.	Genes that showed decreased expression after24 hours of infection by fungi Drechmeria coniospora.	Differentially regulated genes based on fold change, corresponding to the uppermost 18.75th percentile of datasets formed using genes with normalized, expression ratios (infected/control) >1.01 or <0.99 in at least ten out of fourteen arrays are shown.	WBPaper00032031:DConiospora_downregulated_OligoArray_24h
	Coexpression clique No. 282, srj-21-srh-32, on the genome-wide coexpression clique map for the nematode GPL200 platform.	All available microarray datasets for the GPL200 platform (Affymetrix C. elegans Genome Array) were obtained from the GEO repository. This included 2243 individual microarray experiments. These were normalized against each other with the software RMAexpress (Bolstad, 2014). Based on these normalized values, Pearsons correlation coefficients were obtained for each probe-probe pair of the 22,620 probes represented on this array type. The resulting list of correlation coefficients was then ranked to generate the ranked coexpression database with information on each probe represented on the GPL200 platform.	WBPaper00061527:srj-21-srh-32
	Single-cell RNA-Seq cell group 53_0 expressed in neuron.	scVI 0.6.0	WBPaper00065841:53_0
	Top 300 transcripts enriched in ASEL, ASER according to single cell RNAseq.	Top 300 enriched transcripts were determined by log2.ratio of the tpm in the cell type vs the tpm in the other cells * the log2 of the cell.type tpm.	WBPaper00061340:ASE
	Top 300 transcripts enriched in ASKL, ASKR according to single cell RNAseq.	Top 300 enriched transcripts were determined by log2.ratio of the tpm in the cell type vs the tpm in the other cells * the log2 of the cell.type tpm.	WBPaper00061340:ASK
control(maintained under normal lab light (mostly dark, in incubators).) vs UVC-exposed(exposed to 7.5 J/m2 UVC radiation 3 times, 24 h apart (48 h total).) at just prior to the second UVC dose (24h).	Genes differentially expressed in control vsafter UVC exposure without EtBr treatment, at the -25h timepoint (just prior to the second UVC dose (24h))	Transcripts were defined as fold-change >1.2, p < 0.05 based on Rosetta Resolver analysis for all pairwise treatment comparisons. The fold-change refers to the second intensity over the first.	WBPaper00041939:control_vs_UVC-exposed_24h
	Single-cell RNA-Seq cell group 63_0 expressed in neuron.	scVI 0.6.0	WBPaper00065841:63_0
	Genes down-regulated in wdr-23(tm1817) mutants comparing to in N2.	Differentially expressed genes at false discovery rate (FDR) of 0.05 were identified using the Cuffdiff module of the Cufflinks package.	WBPaper00042215:wdr-23(tm1817)_downregulated

7 Expression Patterns

• Primary Identifier: Expr2034580
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr6677
• Remark: Strain: BC11822
• Reporter Gene: [srg-9::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CATCTGATTCGTGTTGCTTCA] 3' and primer B 5' [ATGAAATGGTGAGTTTCCCAA] 3'.
• Pattern: Adult Expression: unidentified cells in head; unidentified cells in tail ; Larval Expression: intestine; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr1019410
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr14049
• Pattern: ASK, ASI, one neuron pair anterior to ASK, a couple more neurons - quite mosaic and variable

• Primary Identifier: Expr7915
• Remark: Picture: Figure 2. Reporter gene fusion type not specified.
• Pattern: Expressed in less than 10 neurons but not ASE.

• Primary Identifier: Expr2016356
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1156746
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

5 GO Annotation

0 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00005167
• Start: 6255459
• End: 6256775
• Strand: -1

5 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 1317

1 Sequence Ontology Term

• Name: gene

1 Strains

• WBStrain00001896

0 Upstream Intergenic Region