WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00005680 Gene Name  sru-17
Sequence Name  ? T04A11.10 Organism  Caenorhabditis elegans
Automated Description  Predicted to be located in membrane. Expressed in neurons. Biotype  SO:0001217
Genetic Position  IV :5.99877 ±0.001291 Length (nt)  ? 1685
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00005680

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:T04A11.10.1 T04A11.10.1 993   IV: 12505697-12507381
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:T04A11.10 T04A11.10 993   IV: 12505697-12505930

4 RNAi Result

WormBase ID
WBRNAi00018094
WBRNAi00056586
WBRNAi00020597
WBRNAi00065309

35 Allele

Public Name
gk964278
gk964078
gk964500
gk962765
gk962743
gk964475
WBVar02122613
WBVar02124597
WBVar02124705
WBVar01954077
WBVar02088284
WBVar01954076
WBVar01454595
WBVar02008342
gk388743
gk892342
gk382374
gk422674
WBVar02059403
gk496048
gk798153
gk558298
gk480574
gk794174
WBVar01569939
WBVar01731334
WBVar01731335
WBVar01859698
WBVar01859699
WBVar01859700

1 Chromosome

WormBase ID Organism Length (nt)
IV Caenorhabditis elegans 17493829  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00005680 12505697 12507381 1

3 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  

1 Downstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrIV_12507382..12507408   27 IV: 12507382-12507408 Caenorhabditis elegans

18 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
  mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis. Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05. WBPaper00045420:fertilization_downregulated_transcript
  Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology. DESEQ2, fold change > 2 and FDR < 0.01. WBPaper00062103:neuron_enriched
  Transcripts that showed significantly increased expression in ogt-1(ok1474) neuronal cells isolated by FACs comparing to in FACs isolated neuronal cells from wild type. DESeq2, fold change > 2, FDR < 0.05. WBPaper00066485:ogt-1(ok1474)_upregulated_neuron
  Coexpression clique No. 203, sre-33-ZK1025.1_8337, on the genome-wide coexpression clique map for the nematode GPL200 platform. All available microarray datasets for the GPL200 platform (Affymetrix C. elegans Genome Array) were obtained from the GEO repository. This included 2243 individual microarray experiments. These were normalized against each other with the software RMAexpress (Bolstad, 2014). Based on these normalized values, Pearsons correlation coefficients were obtained for each probe-probe pair of the 22,620 probes represented on this array type. The resulting list of correlation coefficients was then ranked to generate the ranked coexpression database with information on each probe represented on the GPL200 platform. WBPaper00061527:sre-33-ZK1025.1_8337
  Maternal class (M): genes that are called present in at least one of the three PC6 replicates. A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing. [cgc5767]:expression_class_M
  Strictly maternal class (SM): genes that are the subset of maternal genes that are not also classified as embryonic. A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing. [cgc5767]:expression_class_SM
  Transcripts that showed differential expression in dauer mir-34(gk437) vs dauer mir-34(OverExpression) animals at 20C. N.A. WBPaper00050488:mir-34(gk437)_vs_mir-34(OverExpression)_regulated_dauer_20C
  Significantly downregulated genes from cyc-1(RNAi) microarrays using SAM algorithm with an FDR < 0.1 from adult-only chips. SAM algorithm with an FDR < 0.1. WBPaper00033065:cyc-1(RNAi)_downregulated
  Genes with expression 1.5X depleted in PVD and OLL neurons. Data sets were normalized by RMA and transcripts showing relative PVD enrichment (>=1.5X) vs. the reference sample were identified by SAM analysis (False Discovery Rate, FDR < 1%) WBPaper00036375:depleted_in_PVD_OLL
  Genes expressed in embryonic motor neurons (identified by unc-4::GFP expressing cells). Genes called Present by MAS 5.0 in 2 out of 3 unc-4::GFP hybridizations. WBPaper00025141:unc-4::GFP_Expressed_Genes
  Genes with small RNAs downregulated in all four meg-3(ax3055) meg-4(ax3052) strains comparing to N2 DESeq2 WBPaper00057162:meg-3_meg-4_downregulated_sRNA
  Genes that showed significantly increased expression after exposure to adsorbable organic bromine compounds (AOBr) contained in M. aeruginosa batch culture. Differentially expressed genes (DEGs) were identified with a random variance t-test and a significance analysis of microarrays (SAM) test. Genes were considered statistically significant if their p-value was less than 0.05, the false discovery rate less than 0.3, and the fold change compared to control at least <= 0.67 or >=1.5. WBPaper00046853:AOBr_M.aeruginosa-batch-culture_upregulated
  Genome-wide analysis of developmental and sex-regulated gene expression profile. self-organizing map cgc4489_group_5
  Transcripts that showed significantly decreased expression in dpy-21(e428) comparing to in N2 during L3 stage. DESeq v1.6.3. Fold change > 1.5. WBPaper00050370:dpy-21(e428)_L3_downregulated
  Transcripts that showed significantly decreased expression in Day 8 adults comparing to in Day 1 adults in neuron cells. t-test, fold change > 2, p-value < 0.01. WBPaper00062590:Aging_downregulated_neuron
  Single-cell RNA-Seq cell group 62_0 expressed in neuron. scVI 0.6.0 WBPaper00065841:62_0
  Class B gene expression showed up regulation in lin-14(lf) in L1, no change in lin-4(lf) in L2. Raw data from each experiment were downloaded from the Stanford Microarray Database into Excel files and processed as follows: (i) sort by Spot Flag and discard any rows where the Spot Flag value was nonzero, indicating a bad PCR; (ii) sort by Failed and discard any rows where the Failed value was nonzero, indicating abnormal hybridization; (iii) import into a common file for each type of experiment (i.e., lin-14 or lin-4) the columns from each raw experimental file [RAT2(R/G), which shows a log base 2 transformed ratio of normalized red/green signal for each spot; name of spot (Wormbase designation); chromosome location and description (www.wormbase.org)]; (iv) calculate an average RAT2(R/G) based on the 2 or 3 values (avg; any rows which had only one good experimental value were discarded); (v) calculate a standard deviation (stdev) for the average value; (vi) calculate a t value for each spot by using the formula t = avg*[sqrt(n - 1)]/stdev, where n is the number of experiments for which good data exist, sqrt is square root, and stdev is standard deviation; (vii) sort by absolute t value and discard any rows with a t value below 4.303 (below 95% confidence interval for three experiments) or below 12.706 (below 95% confidence interval for two experiments); (viii) sort by absolute average value and discard any rows with average values below 1.0 (less than twofold change compared to control). WBPaper00026952:class_B

5 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Strain: BC11911 [sru-17::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGAGTCCAGAAAGACGTCTGAA] 3' and primer B 5' [GGCTGGCTGGAAGGATAAA] 3'. Expr6583 Adult Expression: intestine; Nervous System; head neurons; tail neurons; Larval Expression: Nervous System; head neurons; tail neurons;  
    Expr14157 ADL and ASI (both relatively dim), some pharyngeal neurons, other dim cells (could be neurons), inter/motorneuron from RVG, (PVQ), cells close to the tip of the nose (support cells?)  
Original chronogram file: chronogram.1351.xml [T04A11.10:gfp] transcriptional fusion. Chronogram332    
    Expr1155948 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  
    Expr1012326 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

1 GO Annotation

Annotation Extension Qualifier
  located_in

0 Homologues

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00005680 12505697 12507381 1

1 Ontology Annotations

Annotation Extension Qualifier
  located_in

0 Regulates Expr Cluster

1 Sequence

Length
1685

1 Sequence Ontology Term

Identifier Name Description
gene  

1 Strains

WormBase ID
WBStrain00001942

1 Upstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrIV_12504127..12505696   1570 IV: 12504127-12505696 Caenorhabditis elegans