WormMine: Gene WBGene00006004

• WormBase Gene ID: WBGene00006004
• Gene Name: srx-113
• Sequence Name: F56H9.1
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to be located in membrane. Expressed in FLP and tail neurons.
• Biotype: SO:0001217
• Genetic Position: V :4.5324 ±0.001866
• Length (nt): 1979

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00006004

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:F56H9.1.1	F56H9.1.1	960	V: 12630170-12632148

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:F56H9.1	F56H9.1	960	V: 12630170-12630284

0 RNAi Result

25 Allele

• gk963271
• gk963301
• gk964458
• gk964459
• gk963618
• WBVar02061501
• WBVar01868191
• gk605194
• gk497766
• gk913105
• gk788127
• gk839674
• gk586649
• gk683284
• gk629907
• WBVar02076132
• gk250005
• gk250003
• gk250004
• WBVar00099933
• WBVar00009965
• WBVar01808850
• WBVar00009970
• WBVar01808849
• WBVar00009975

1 Chromosome

• WormBase ID: V
• Organism: Caenorhabditis elegans
• Length (nt): 20924180

1 Chromosome Location

• Feature . Primary Identifier: WBGene00006004
• Start: 12630170
• End: 12632148
• Strand: -1

3 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrV_12629844..12630169
• Length (nt): 326
• Chromosome Location: V: 12629844-12630169
• Organism: Caenorhabditis elegans

11 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
	Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology.	DESEQ2, fold change > 2 and FDR < 0.01.	WBPaper00062103:neuron_enriched
	Transcripts that showed significantly increased expression in csr-1a(tor159) comparing to in N2 at 25C.	DESeq2, fold change > 2, p-value < 0.05.	WBPaper00061753:csr-1(tor159)_upregulated_25C
	Transcripts that showed significantly increased expression in ogt-1(ok1474) neuronal cells isolated by FACs comparing to in FACs isolated neuronal cells from wild type.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00066485:ogt-1(ok1474)_upregulated_neuron
Bacteria infection: Enterococcus faecalis	Genes with increased expression after 24 hours of infection by E.faecalis Fold changes shown are pathogen vs OP50.	For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated.	WBPaper00038438:E.faecalis_24hr_upregulated_TilingArray
	Transcripts that showed significantly increased expression in ilc-17.1(syb5296) comparing to in N2 animals at L4 larva stage.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00066594:ilc-17.1(syb5296)_upregulated
	Transcripts that showed differential expression in dauer mir-34(gk437) vs dauer mir-34(OverExpression) animals at 20C.	N.A.	WBPaper00050488:mir-34(gk437)_vs_mir-34(OverExpression)_regulated_dauer_20C
	Transcripts that showed differential expression in dauer N2 vs dauer mir-34(gk437) animals at 20C.	N.A.	WBPaper00050488:N2_vs_mir-34(gk437)_regulated_dauer_20C
	Transcripts that showed significantly increased expression in eat-2(ad1113) comparing to in N2.	DESeq2. The genes with a fold change >= 2 and a false discovery rate (FDR) < 0.05 in a comparison were identified as significant DEGs.	WBPaper00065746:eat-2(ad1113)_upregulated
	Genes that showed significantly increased expression level in rsr-2(RNAi) animals comparing to in gfp(RNAi) control.	Fold change > 1.2 or < 0.8.	WBPaper00042477:rsr-2(RNAi)_upregulated_TilingArray

5 Expression Patterns

• Primary Identifier: Expr6236
• Remark: Strain: BC15808
• Reporter Gene: [srx-113::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCACCACATTGGAATGGAGA] 3' and primer B 5' [GTTTCGTTGTTTCTTAGGCCC] 3'.
• Pattern: Adult Expression: Nervous System; head neurons; tail neurons; Larval Expression: Nervous System; head neurons; tail neurons

• Primary Identifier: Expr15424

• Primary Identifier: Expr14188
• Pattern: FLP, 4 more head neuron pairs, PLM, DVA

• Primary Identifier: Expr1152539
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr1026860
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00006004
• Start: 12630170
• End: 12632148
• Strand: -1

1 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 1979

1 Sequence Ontology Term

• Name: gene

0 Strains

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrV_12632149..12632489
• Length (nt): 341
• Chromosome Location: V: 12632149-12632489
• Organism: Caenorhabditis elegans