WormMine: Gene WBGene00006149

• WormBase Gene ID: WBGene00006149
• Gene Name: str-90
• Sequence Name: F58G4.2
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable G protein-coupled olfactory receptor activity. Predicted to be involved in G protein-coupled receptor signaling pathway and olfactory behavior. Predicted to be located in plasma membrane. Expressed in neurons.
• Biotype: SO:0001217
• Genetic Position: V :1.01196 ±0.00071
• Length (nt): 3763

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00006149

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:F58G4.2.1	F58G4.2.1	1142	V: 8103260-8107022

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:F58G4.2	F58G4.2	1020	V: 8103265-8103450

7 RNAi Result

• WBRNAi00049049
• WBRNAi00049050
• WBRNAi00016012
• WBRNAi00023248
• WBRNAi00023498
• WBRNAi00023760
• WBRNAi00024046

44 Allele

• gk963301
• gk964351
• gk962860
• gk964047
• gk964046
• WBVar01862896
• WBVar01862895
• WBVar01589997
• gk240738
• gk240739
• gk240740
• gk240741
• gk240742
• gk240743
• gk240736
• gk240737
• otn16561
• otn18328
• WBVar01460865
• WBVar01741480
• gk376229
• gk607998
• gk357951
• gk655019
• gk653377
• gk827564
• WBVar00213267
• WBVar01913522
• gk786191
• gk692575

1 Chromosome

• WormBase ID: V
• Organism: Caenorhabditis elegans
• Length (nt): 20924180

1 Chromosome Location

• Feature . Primary Identifier: WBGene00006149
• Start: 8103260
• End: 8107022
• Strand: 1

3 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrV_8107023..8107866
• Length (nt): 844
• Chromosome Location: V: 8107023-8107866
• Organism: Caenorhabditis elegans

16 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology.	DESEQ2, fold change > 2 and FDR < 0.01.	WBPaper00062103:neuron_enriched
	Transcripts that showed significantly increased expression in ogt-1(ok1474) neuronal cells isolated by FACs comparing to in FACs isolated neuronal cells from wild type.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00066485:ogt-1(ok1474)_upregulated_neuron
	Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(-), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage.	DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2.	WBPaper00050859:upregulated_P-granule(-)GFP(-)_vs_control_day2-adult
	Genes found to be regulated by low-copy overexpression of sir-2.1 with p < 0.014.	N.A.	WBPaper00026929:sir-2.1_overexpression_regulated
Bacteria infection: Serratia marcesens	Genes up-regulated in animals infected with Serratia marcesens compared to the E. coli OP50 control after 24h of infection.	MAANOVA and BRB-Array-Tools.	WBPaper00030985:Serratia_marcesens_upregulated
Bacteria infection: Enterococcus faecalis	Genes with increased expression after 24 hours of infection by E.faecalis Fold changes shown are pathogen vs OP50.	For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated.	WBPaper00038438:E.faecalis_24hr_upregulated_RNAseq
	Transcripts that showed significantly decreased expression in unc-70(cas983) comparing to in N2 at L1 larva stage.	DESeq2, fold change >= 2, FDR <= 0.05	WBPaper00057041:unc-70(cas983)_downregulated
	Genes that showed significantly increased expression level in rsr-2(RNAi) animals comparing to in gfp(RNAi) control.	Fold change > 1.2 or < 0.8.	WBPaper00042477:rsr-2(RNAi)_upregulated_TilingArray
	Transcripts that showed significantly decreased expression in dpy-21(e428) comparing to in N2 during L3 stage.	DESeq v1.6.3. Fold change > 1.5.	WBPaper00050370:dpy-21(e428)_L3_downregulated
	Top 300 transcripts enriched in AIAL, AIAR according to single cell RNAseq.	Top 300 enriched transcripts were determined by log2.ratio of the tpm in the cell type vs the tpm in the other cells * the log2 of the cell.type tpm.	WBPaper00061340:AIA
	Single-cell RNA-Seq cell group 104_0 expressed in neuron.	scVI 0.6.0	WBPaper00065841:104_0
	Coexpression clique No. 282, srj-21-srh-32, on the genome-wide coexpression clique map for the nematode GPL200 platform.	All available microarray datasets for the GPL200 platform (Affymetrix C. elegans Genome Array) were obtained from the GEO repository. This included 2243 individual microarray experiments. These were normalized against each other with the software RMAexpress (Bolstad, 2014). Based on these normalized values, Pearsons correlation coefficients were obtained for each probe-probe pair of the 22,620 probes represented on this array type. The resulting list of correlation coefficients was then ranked to generate the ranked coexpression database with information on each probe represented on the GPL200 platform.	WBPaper00061527:srj-21-srh-32
	Genome-wide analysis of developmental and sex-regulated gene expression profile.	self-organizing map	cgc4489_group_6
	Genes predicted to be downregulated more than 2.0 fold in rrf-3(pk1426) mutant worms as compared to wild-type animals (t-test P-value < 0.05).	A t-test (5% confidence) was applied to the triplicate sample data for each transcript in each mutant to identify genes significantly elevated or decreased compared with the wild type.	WBPaper00027111:rrf-3(pk1426)_downregulated

5 Expression Patterns

• Primary Identifier: Expr1019002
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr6256
• Remark: Also expressed in (comments from author) : ADL amphid neuron; PHA + PHB phasmid neurons. Expression in 3 other non-DiI stained, non-ASE/AWC head neurons (Hobert Lab 2005). Strain: BC13455
• Reporter Gene: [str-90::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ACCATTGTAAACAAATTGCTCGT] 3' and primer B 5' [AAAATCGAGCAAGATCATCTGAA] 3'.
• Pattern: Adult Expression: Nervous System; head neurons; amphids; tail neurons; phasmids; Larval Expression: Nervous System; head neurons; amphids; tail neurons; phasmids

• Primary Identifier: Expr14217
• Pattern: ADL, sometimes ASH, sometimes dim ASI, sometimes another dim pair, 1 midline neuron in btw ASJs, PHA, PHB

• Primary Identifier: Expr1152791
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr2017090
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

6 GO Annotation

0 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00006149
• Start: 8103260
• End: 8107022
• Strand: 1

6 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 3763

1 Sequence Ontology Term

• Name: gene

1 Strains

• WBStrain00002598

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrV_8100514..8103259
• Length (nt): 2746
• Chromosome Location: V: 8100514-8103259
• Organism: Caenorhabditis elegans