WormMine: Gene WBGene00006321

• WormBase Gene ID: WBGene00006321
• Gene Name: sup-12
• Sequence Name: T22B2.4
• Brief Description: sup-12 encodes an RNA-binding protein that contains a conserved RNA recognition motif (RRM); during development, SUP-12 functions as a muscle-specific splicing factor to regulate alternative pre-mRNA processing of unc-60 and egl-15 transcripts; in vitro, SUP-12 can bind intronic regions of the unc-60 and egl-15 pre-mRNAs; specifically, SUP-12 binds the unc-60 intron 1A cooperatively with ASD-2, with which it physically interacts, to regulate alternative unc-60 pre-mRNA processing; a sup-12::gfp promoter fusion is expressed in body wall muscle and the pharynx; in body wall muscle, SUP-12::GFP localizes to nuclei in a speckled pattern.
• Organism: Caenorhabditis elegans
• Automated Description: Enables pre-mRNA intronic binding activity and single-stranded RNA binding activity. Involved in several processes, including alternative mRNA splicing, via spliceosome; regulation of actin cytoskeleton organization; and regulation of alternative mRNA splicing, via spliceosome. Located in nuclear speck. Part of ribonucleoprotein complex. Is an ortholog of human RBM24 (RNA binding motif protein 24) and RBM38 (RNA binding motif protein 38).
• Biotype: SO:0001217
• Genetic Position: X :-9.16547 ±0.055758
• Length (nt): 3090

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00006321

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:T22B2.4b.1	T22B2.4b.1	1330	X: 3904584-3907673
Transcript:T22B2.4b.2	T22B2.4b.2	1938	X: 3904589-3907657
Transcript:T22B2.4a.1	T22B2.4a.1	1275	X: 3904591-3907671

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:T22B2.4a	T22B2.4a	747	X: 3904639-3904720
CDS:T22B2.4b	T22B2.4b	456	X: 3904639-3904720

4 RNAi Result

• WBRNAi00053785
• WBRNAi00062575
• WBRNAi00035785
• WBRNAi00062574

80 Allele

• gk963725
• gk964260
• gk963632
• gk964060
• s2896
• s2900
• s2910
• st86
• st89
• st203
• WBVar00077309
• WBVar00077310
• gk276938
• gk276937
• gk276936
• gk276935
• gk276934
• gk276933
• gk276932
• gk276931
• gk276943
• gk276942
• gk276941
• gk276940
• gk276939
• WBVar02044557
• yb1010
• yb1011
• yb995
• yb1247

1 Chromosome

• WormBase ID: X
• Organism: Caenorhabditis elegans
• Length (nt): 17718942

1 Chromosome Location

• Feature . Primary Identifier: WBGene00006321
• Start: 3904584
• End: 3907673
• Strand: 1

3 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrX_3907674..3908143
• Length (nt): 470
• Chromosome Location: X: 3907674-3908143
• Organism: Caenorhabditis elegans

173 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals.	Fold change > 2, FDR < 0.01.	WBPaper00065993:glp-1(e2141)_upregulated
	Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin-Allantoin_upregulated
	Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin_upregulated
	Transcripts that showed significantly increased expression after animals were treated with 100uM Psora and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Psora-Allantoin_upregulated
	Transcripts that showed significantly increased expression after animals were treated with 100uM Rapamycin and 50mM Metformin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Metformin_upregulated
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts that showed significantly decreased expression at 5-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites.	DESeq2, fold change > 2, FDR < 0.05	WBPaper00065835:Day5_vs_Day1_downregulated
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Transcripts that showed significantly increased expression in rrf-3(pk1426) comparing to in N2 at embryo stage.	DESeq2v 1.18.1, fold change > 1.5, adjusted p-value < 0.01.	WBPaper00056169:rrf-3(pk1426)_upregulated_embryo
	Transcripts that showed significantly increased expression after four-day-old young adult worms were placed on NGM plates seeded with OP50 in the presence 5% Agaro-oligosaccharides(AGO) for 24 h, comparing to animals grown in the absence of AGO.	Fold change > 2.	WBPaper00064306:Agaro-oligosaccharides_upregulated
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
	Genes that showed significantly increased expression in daf-2(e1370);hel-1(gk148684) comparing to in hel-1(gk148684)	To identify DEGs, Students t test and the log2 median ratio test were performed to compute t values and median ratios for all the annotated genes. The adjusted P values from each test were computed using an empirical distribution of the null hypothesis, which was obtained from random permutations of the samples. Finally, the adjusted P values from the individual tests were combined to compute the overall P values using Stouffers method , and genes with overall P < 0.05 and fold change > 1.5 were selected as DEGs.	WBPaper00047131:daf-2(e1370)_upregulated_hel-1(gk148684)-background
	Genes that showed significantly increased expression in daf-2(e1370) comparing to in N2.	To identify DEGs, Students t test and the log2 median ratio test were performed to compute t values and median ratios for all the annotated genes. The adjusted P values from each test were computed using an empirical distribution of the null hypothesis, which was obtained from random permutations of the samples. Finally, the adjusted P values from the individual tests were combined to compute the overall P values using Stouffers method , and genes with overall P < 0.05 and fold change > 1.5 were selected as DEGs.	WBPaper00047131:daf-2(e1370)_upregulated_N2-background
	Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage.	DESeq2 version 1.22.2, p < 0.05	WBPaper00064716:paraquat_downregulated
	Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	DESeq2, fold change > 2, adjusted p-value < 0.01	WBPaper00058598:sin-3(tm1276)_downregulated
	Expression Pattern Group C, enriched for genes involved in metabolic processes.	The significance (P 0.0001) of the relative age (time) was used to determine if a gene was differentially expressed between the three age (time) groups. The effect of this factor explaining gene expression differences was used to determine if the expression went up or down during the two age/time periods (t1 - t2 and t2 -t3). Authors used a permutation approach to determine the thresholds for the different mapping strategies. For each of the used models for eQTL mapping, authors used 23,000 permutations. For each permutation, authors randomly picked a spot; each spot could only be picked once. The gene expression and relative lifespan values were than randomly distributed over the RILs (and time points) and used for mapping. In this way, authors obtained a threshold for each of the explaining factors. For the single time points, authors used a FDR of 0.01 to adjust for multiple testing. The genome-wide threshold for this FDR is -log10 P = 3.8 for each of the three time points. For the combined models (t1 to t2 and t2 to t3), authors used a genome-wide threshold of -log10 P = 4, which resembles an FDR of 0.006, 0.001, and 0.006 for marker, age, and the interaction between marker and age, respectively. To determine the threshold for the single gene examples, authors used 1000 permutations as in the genome-wide threshold. The difference is that they use the gene under study in all of the permutations. The P-values for the gene specific thresholds were determined at FDR = 0.05.	WBPaper00036286:Pattern_C
	Transcripts depleted in purified oocyte P bodies comparing to in the whole animal.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_WholeAnimal_depleted
	Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy.	Cufflinks	WBPaper00065120:body-muscle-transcriptome
	Transcripts that showed significantly increased expression in hda-1(ne4752[3xFLAG-Degron-HDA-1]) in gonads dissected from 1-day old adult animals.	Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R.	WBPaper00061479:hda-1(ne4752)_upregulated
	Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals.	DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2.	WBPaper00062159:hda-2(ok1479)_upregulated
	Transcripts that showed significantly increased expression in npr-15(tm12539) comparing to in N2 at L4 larva stage.	Fold change > 2, FDR < 0.05.	WBPaper00066608:npr-15(tm12539)_upregulated
	Transcripts that showed significantly decreased expression in set-2(tm1630) animals at embryo stage, comparing to in N2 animals.	DESeq2 (v2.1.8.3) was used to determine DE genes and to generate principal component and scatter plots. DE genes with FDR < 0.05 were analysed using g:Profiler with Bonferroni correction.	WBPaper00060014:set-2(tm1630)_downregulated

9 Expression Patterns

• Primary Identifier: Expr2035261
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr6740
• Remark: Strain: BC11841
• Reporter Gene: [T22B2.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTCTTTTGCGACCACATCAG] 3' and primer B 5' [GGA CTT GGC CGT AGA TT] 3'.
• Pattern: Adult Expression: pharynx; anal depressor muscle; unidentified cells; Larval Expression: pharynx; intestine; body wall muscle; unidentified cells

• Primary Identifier: Expr6741
• Remark: Also expressed in (comments from author) : Larval and embryo incomplete. Strain: BC11122
• Reporter Gene: [T22B2.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTC TTT TGC GAC CAC ATC AG] 3' and primer B 5' [GGA CTT GGC CGT AGA TT] 3'.
• Pattern: Adult Expression: pharynx; Reproductive System; vulval muscle; body wall muscle

• Primary Identifier: Expr3470
• Remark: Although the myo-3 promoter is active in the body wall muscle but not in the pharynx, myo-3 driven expression of GFP-SUP-12 was sufficient to rescue the Sup-12 mutant phenotype, indicating that GFP-SUP-12 is functional and expression of SUP-12 in the body wall muscle is functionally important for its interaction with unc-60. These results strongly suggest that SUP-12 is a muscle-specific regulator of pre-mRNA splicing in the nucleus.
• Pattern: The 3.1-kb promoter region of the sup-12 gene was able to drive expression of a reporter GFP in body wall muscle and pharynx.
• Subcellular Localization: GFP-tagged SUP-12, which was expressed in the body wall muscle under the control of the myo-3 promoter, predominantly localized to the nuclei. Within the nuclei, GFP-SUP-12 was found in diffuse and often speckled patterns in the nucleoplasm but excluded from the globular region, possibly representing the nucleolus. The speckled localization of SUP-12 in the nucleus is similar to patterns that are commonly observed for other splicing factors.

• Primary Identifier: Expr1032553
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Chronogram849
• Remark: Original chronogram file: chronogram.1891.xml
• Reporter Gene: [T22B2.4:gfp] transcriptional fusion.

• Primary Identifier: Expr1157336
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr1028589
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr2017125
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

16 GO Annotation

0 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00006321
• Start: 3904584
• End: 3907673
• Strand: 1

16 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 3090

1 Sequence Ontology Term

• Name: gene

4 Strains

• WBStrain00033510
• WBStrain00036719
• WBStrain00001906
• WBStrain00001641

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrX_3903488..3904583
• Length (nt): 1096
• Chromosome Location: X: 3903488-3904583
• Organism: Caenorhabditis elegans