WormMine

WS296

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00005237 Gene Name  srh-11
Sequence Name  ? R09F10.6 Organism  Caenorhabditis elegans
Automated Description  Predicted to be located in membrane. Expressed in several structures, including PQR; PVT; head muscle; lateral ganglion; and ray. Biotype  SO:0001217
Genetic Position  X :-0.161777 ±0.00438 Length (nt)  ? 1414
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00005237

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:R09F10.6.1 R09F10.6.1 1035   X: 8317637-8319050
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:R09F10.6 R09F10.6 1035   X: 8317637-8317845

2 RNAi Result

WormBase ID
WBRNAi00051640
WBRNAi00009055

40 Allele

Public Name
gk964260
gk962707
gk964193
gk964194
gk963896
gk963732
WBVar01927619
gk964126
tm11434
tm11437
WBVar00240845
otn11670
WBVar01690179
WBVar01690180
WBVar00053756
WBVar00236486
WBVar00053761
gk287186
WBVar00053766
gk287190
gk287189
gk287188
WBVar01470094
gk287187
gk540445
WBVar01885145
gk526538
tm2102
WBVar01885144
WBVar01470093

1 Chromosome

WormBase ID Organism Length (nt)
X Caenorhabditis elegans 17718942  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00005237 8317637 8319050 -1

3 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  

1 Downstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrX_8316279..8317636   1358 X: 8316279-8317636 Caenorhabditis elegans

25 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts of coding genes that showed significantly decreased expression in muscle. DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed. WBPaper00062325:muscle_depleted_coding-RNA
  mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis. Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05. WBPaper00045420:fertilization_downregulated_transcript
  TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood. SAM WBPaper00031040:TGF-beta_adult_upregulated
  Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology. DESEQ2, fold change > 2 and FDR < 0.01. WBPaper00062103:neuron_enriched
Bacteria infection: Photorhabdus luminescens Genes down-regulated in animals infected with Photorhabdus luminescens compared to the E. coli OP50 control after 24h of infection. MAANOVA and BRB-Array-Tools. WBPaper00030985:Photorhabdus_luminescens_downregulated
  Genes down-regulated following nhr-25(RNAi). Pair-wise significance testing (mutant/RNAi vs. wild-type/vector) was performed using the Bioconductor package limma and p-values were initially corrected for multiple testing using the false discovery rate (FDR) method of Benjamini and Hochberg. Authors defined differential expression as log2(ratio) >= 0.848 with the FDR set to 5%, and p-value <= 0.001. WBPaper00045015:nhr-25(RNAi)_downregulated
  Genes found to be regulated by low-copy overexpression of sir-2.1 with p < 0.014. N.A. WBPaper00026929:sir-2.1_overexpression_regulated
  Transcripts down regulated in hpl-2(tm1489) embryo comparing to N2 in tiling array analysis. Oligos from the tiling array were mapped to chromosome coordinates of the exons from Wormbase WS180. Any oligo that mapped to a gene on both the Watson and Crick strands was excluded. The remaining oligos were then grouped together (perfect match and mismatch) into probe sets and written out into an Affymetrix CDF file. The CDF file was converted into an R-package and loaded into R. The expression values were calculated using the justRMA function from Bioconductor. This used a Benjamini and Hochberg false discovery rate correction. WBPaper00040560:hpl-2_embryo_downregulated
  Genes expressed in N2. Expressed transcripts were identified on the basis of a Present call in 3 out of 4 N2 experiments as determined by Affymetrix MAS 5.0. WBPaper00025141:N2_Expressed_Genes
  Transcripts that showed significantly increased expression in daf-2(e1370) neurons comparing to in N2 neurons at day 8adult stage. DESeq2, FDR < 0.05, fold change > 2. WBPaper00066978:daf-2(e1370)_upregulated_neuron
  Transcripts that showed significantly increased expression in daf-16(mu86);daf-2(e1370) neurons comparing to in daf-2(e1370) neurons at day 8adult stage. DESeq2, FDR < 0.05, fold change > 2. WBPaper00066978:daf-16(mu86)_upregulated_neuron
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:intestine_L1-larva_expressed
  Genes expressed in embryonic motor neurons (identified by unc-4::GFP expressing cells). Genes called Present by MAS 5.0 in 2 out of 3 unc-4::GFP hybridizations. WBPaper00025141:unc-4::GFP_Expressed_Genes
  Genes with no change in hcf-1(-), no change in sir-2.1(O/E) and upregulated in daf-2(-). To identify the genes that show consistent and significant expression changes across the independent biological replicates of hcf-1(-) or sir-2.1(O/E), authors used Significance Analysis of Microarrays (SAM) with a stringent criteria of expected false discovery rate (FDR) set at 0%. WBPaper00040184:hcf-1nc_sir-2.1nc_daf-2up
  Down-regulated genes (fold change > 1.5) in two CoQ-deficient clk-1 mutant strains (e2519, qm30) compared to wild types N2. Fold-changes of intensities were calculated from the arithmetic mean of gene expression values between experimental and corresponding control group. Fold change >= 1.5 was used as cut-off. WBPaper00045774:clk-1_downregulated
Bacteria infection: Enterococcus faecalis Genes down-regulated in animals infected with Enterococcus faecalis compared to the E. coli OP50 control after 24h of infection. MAANOVA and BRB-Array-Tools. WBPaper00030985:Enterococcus_faecalis_downregulated
  Genes that showed significantly decreased expression level in rsr-2(RNAi) animals comparing to in gfp(RNAi) control. Fold change > 1.2 or < 0.8. WBPaper00042477:rsr-2(RNAi)_downregulated_TilingArray
  Transcripts depleted at neuron synapses (enriched at the somatic fragments) by comparing presynaptic and somatic cell fragments labeled with different protein markers and sorted by FACS. DESeq2, FDR < 0.05 WBPaper00059027:neuron-synapses_depleted
  Enriched in ventral nerve cord (larva), vulval muscle (adult), ventral nerve cord (adult), body neurons (adult), body neurons (larva), dorsal nerve cord (adult), tail neurons (larva), dorsal nerve cord (larva), nerve ring (adult), nerve ring (larva), tail neurons (adult), body wall muscle (larva).   WBPaper00029359_1291
Fungi infection: Drechmeria coniospora. 24 hours of infection. Genes that showed decreased expression after24 hours of infection by fungi Drechmeria coniospora. Differentially regulated genes based on fold change, corresponding to the uppermost 18.75th percentile of datasets formed using genes with normalized, expression ratios (infected/control) >1.01 or <0.99 in at least ten out of fourteen arrays are shown. WBPaper00032031:DConiospora_downregulated_OligoArray_24h
Bacteria infection: Bacillus thuringiensis B-18247 Transcripts that showed significantly decreased expression after 8 hour of exposure of C.elegans strain MY15 to pathogenic B. thuringiensis B-18247. Differential gene expression was assessed with a mixed regression model, including pathogen as a fixed and array as a random factor using the restricted maximum likelihood (REML) approach. The pathogen effect was evaluated with an F3-test using a pooled estimator of the error-variance and comparison of the tabulated p-values with the F distribution rather than a permutation analysis, which was unsuitable for this study because of low sample size (maximum of four replicates). To correct for multiple testing authors adjusted the significance level with the help of the false discovery rate (FDR). WBPaper00040209:B.thuringiensis_downregulated_MY15
  Coexpression clique No. 282, srj-21-srh-32, on the genome-wide coexpression clique map for the nematode GPL200 platform. All available microarray datasets for the GPL200 platform (Affymetrix C. elegans Genome Array) were obtained from the GEO repository. This included 2243 individual microarray experiments. These were normalized against each other with the software RMAexpress (Bolstad, 2014). Based on these normalized values, Pearsons correlation coefficients were obtained for each probe-probe pair of the 22,620 probes represented on this array type. The resulting list of correlation coefficients was then ranked to generate the ranked coexpression database with information on each probe represented on the GPL200 platform. WBPaper00061527:srj-21-srh-32
  Top 300 transcripts enriched in excretory gland cell according to single cell RNAseq. Top 300 enriched transcripts were determined by log2.ratio of the tpm in the cell type vs the tpm in the other cells * the log2 of the cell.type tpm. WBPaper00061340:Excretory_gland
  Genome-wide analysis of developmental and sex-regulated gene expression profile. self-organizing map cgc4489_group_23
  Genes predicted to be downregulated more than 2.0 fold in rrf-1(pk1417) mutant worms as compared to wild-type animals (t-test P-value < 0.05). A t-test (5% confidence) was applied to the triplicate sample data for each transcript in each mutant to identify genes significantly elevated or decreased compared with the wild type. WBPaper00027111:rrf-1(pk1417)_downregulated

8 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
    Expr2034589 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
Also expressed in (comments from author) : ASJ amphid neuron (Thomas Lab 2005) Strain: BC10848 [srh-11::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCATCCATCTTTGAAAATCACA] 3' and primer B 5' [TCTGTTCTCCATTGGGAATAAAAT] 3'. Expr6491 Adult Expression: spermatheca; Nervous System; head neurons; amphids; unidentified cells in head; Larval Expression: intestine; Nervous System; head neurons; amphids; unidentified cells in head;  
Strain: BC10703 [srh-11::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCATCCATCTTTGAAAATCACA] 3' and primer B 5' [TCTGTTCTCCATTGGGAATAAAAT] 3'. Expr6492 Adult Expression: unidentified cells in head; Larval Expression: Nervous System; head neurons; unidentified cells in head;  
    Expr14064 ASJ, AIB, head muscle, vulval cells?, PQR, PVT, ray expression in males  
    Expr1155311 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  
    Expr2016368 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr1010826 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
Original chronogram file: chronogram.284.xml [R09F10.6:gfp] transcriptional fusion. Chronogram1404    

1 GO Annotation

Annotation Extension Qualifier
  located_in

0 Homologues

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00005237 8317637 8319050 -1

1 Ontology Annotations

Annotation Extension Qualifier
  located_in

0 Regulates Expr Cluster

1 Sequence

Length
1414

1 Sequence Ontology Term

Identifier Name Description
gene  

3 Strains

WormBase ID
WBStrain00001539
WBStrain00001538
WBStrain00001477

1 Upstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrX_8319051..8319591   541 X: 8319051-8319591 Caenorhabditis elegans