WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00005165 Gene Name  srg-7
Sequence Name  ? C18F10.8 Organism  Caenorhabditis elegans
Automated Description  Predicted to enable transmembrane signaling receptor activity. Predicted to be involved in sensory perception of chemical stimulus. Predicted to be located in membrane. Expressed in head. Biotype  SO:0001217
Genetic Position  III :-1.40639 ±0.000114 Length (nt)  ? 1678
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00005165

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:C18F10.8.1 C18F10.8.1 1048   III: 6266484-6268161
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:C18F10.8 C18F10.8 1020   III: 6266510-6266681

5 RNAi Result

WormBase ID
WBRNAi00040966
WBRNAi00011017
WBRNAi00005355
WBRNAi00029090
WBRNAi00035489

24 Allele

Public Name
gk964518
gk176274
WBVar01264292
h9100
gk954012
gk585113
gk873520
gk703966
gk366343
snx4393
gk847726
gk404722
gk535124
gk808615
WBVar00062117
ttTi10267
snx701
gk482477
WBVar01566626
snx2561
gk409360
gk808616
gk522830
gk570364

1 Chromosome

WormBase ID Organism Length (nt)
III Caenorhabditis elegans 13783801  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00005165 6266484 6268161 -1

3 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  

0 Downstream Intergenic Region

56 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells. DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction. WBPaper00060811:L1_vs_adult_upregulated_neural
  Transcripts of coding genes that showed significantly decreased expression in muscle. DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed. WBPaper00062325:muscle_depleted_coding-RNA
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
Osmotic stress Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present DESeq(version 1.10.1), FDR < 0.05. WBPaper00050726:OsmoticStress_regulated_Food
  Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology. DESEQ2, fold change > 2 and FDR < 0.01. WBPaper00062103:neuron_enriched
Bacteria infection: Enterococcus faecalis Genes with increased expression after 24 hours of infection by E.faecalis Fold changes shown are pathogen vs OP50. For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated. WBPaper00038438:E.faecalis_24hr_upregulated_TilingArray
  Transcripts that showed significantly increased expression after four-day-old young adult worms were placed on NGM plates seeded with OP50 in the presence 5% Agaro-oligosaccharides(AGO) for 24 h, comparing to animals grown in the absence of AGO. Fold change > 2. WBPaper00064306:Agaro-oligosaccharides_upregulated
  Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2. DESeq2, fold change > 2, p-value < 0.01. WBPaper00061203:sin-3(tm1276)_upregulated
  Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult. DESeq2, fold change > 2, adjusted p-value < 0.01 WBPaper00058598:sin-3(tm1276)_downregulated
  Maternal class (M): genes that are called present in at least one of the three PC6 replicates. A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing. [cgc5767]:expression_class_M
  Strictly maternal class (SM): genes that are the subset of maternal genes that are not also classified as embryonic. A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing. [cgc5767]:expression_class_SM
  Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals. DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2. WBPaper00062159:hda-2(ok1479)_upregulated
  Transcripts that showed significantly decreased expression in set-2(tm1630) animals at embryo stage, comparing to in N2 animals. DESeq2 (v2.1.8.3) was used to determine DE genes and to generate principal component and scatter plots. DE genes with FDR < 0.05 were analysed using g:Profiler with Bonferroni correction. WBPaper00060014:set-2(tm1630)_downregulated
  Genes found to be regulated by low-copy overexpression of sir-2.1 with p < 0.014. N.A. WBPaper00026929:sir-2.1_overexpression_regulated
  Transcripts that showed significantly increased expression in daf-2(e1370) neurons comparing to in N2 neurons at day 8adult stage. DESeq2, FDR < 0.05, fold change > 2. WBPaper00066978:daf-2(e1370)_upregulated_neuron
  Transcripts that showed significantly increased expression in animals fed with JM103 bacteria producing Cry5B, comparing to control animals fed with JM103. ANOVA, p-value < 0.05. WBPaper00056167:Cry5B_upregulated
  Transcripts that showed significantly increased expression in daf-16(mu86);daf-2(e1370) neurons comparing to in daf-2(e1370) neurons at day 8adult stage. DESeq2, FDR < 0.05, fold change > 2. WBPaper00066978:daf-16(mu86)_upregulated_neuron
  Transcripts that showed significantly decreased expression in whole animal day 1 N2 adults comparing to in whole animal day 8 N2 adults. DESeq2, FDR < 0.05, fold change > 2. WBPaper00066978:Day1Adult_vs_Day8Adult_downregulated_neuron
  Transcripts that showed differential expression between 24 and 26 hours post hatching L2d and dauer committed larvae of daf-9(dh, triggered by the dafachronic acid (DA) growth hormone6). Cluster 2 genes' expression gradually increased into dauer. Benjamini Hochberg corrected q-value < 0.01. WBPaper00053388:dauer_regulated_Cluster2
  Genes that showed decreased expression after 1-methylnicotinamide (MNA) treatment. Raw counts for the genes were analyzed using the R Statistical Computing Environment and the Bioconductor packages DESeq and edgeR. Both packages provide statistical routines for determining differential expression in digital gene expression data using a model based on the negative binomial distribution. The resulting p-values were adjusted using the Benjamini and Hochberg's approach for controlling the false discovery rate (FDR). If both FDR values (by DESeq and edgeR) were smaller than p = 0.05, genes were assigned as differentially expressed. WBPaper00044260:1-methylnicotinamide_downregulated
  Transcripts that showed differential expression in dauer mir-34(gk437) vs dauer mir-34(OverExpression) animals at 20C. N.A. WBPaper00050488:mir-34(gk437)_vs_mir-34(OverExpression)_regulated_dauer_20C
  Transcripts that showed significantly increased expression in fmi-1(rh308) young adults comparing to in N2 animals. fold change > 2, p-value < 0.05 WBPaper00066618:fmi-1(rh308)_upregulated
Hypoxia: 7% oxygen. Transcripts that showed significantly increased expression at animals treated with 7% oxygen, comparing to animals grown at 21% oxygen. Fold change > 2, p-value < 0.05. WBPaper00060661:hypoxia_upregulated
  Genes that showed significantly decreased experssion after 22.5 hours of treatment in 200nM delta7-dafachronic acid comparing with in ethanol vehicle control. To identify the differentially expressed genes, we applied Significance Analysis of Microarrays (SAM) analysis using the R package samr [46]. Genes with median false discovery <5% and fold changes >2.0 were considered differentially expressed. WBPaper00046548:dafachronic-acid_downregulated
  Genes that showed significant differential expressed between control and 150 mg\/L Atrazine treatment. t-test, p < 0.05. WBPaper00036123:Atrazine_regulated
  Genes with differential expression under 1.0mg/l Diazinon treatment at 16 centigrade. To identify the differentially expressed genes in each treatment authors used linear models per toxicant and temperature (gene expression = Toxicant (effect) + error). The lm function in R stats package was used to implement the linear models analysis with recommended default options. For threshold determination authors used a permutation approach. For each of the 23,232 permutations used authors randomly picked a transcript (array spot), which could only be picked once. Authors combined all the expression values of this transcript and randomly distributed them over the replicates and used them in the linear model. In this way authors obtained a threshold for each of the toxicants. Authors used a -log10 p-value 2 as common threshold for the analysis, which resembles to the following FDR per toxicant: 0.0155 for CPF at 24 centigrade, 0.0148 for DZN at 24 centigrade, 0.0168 for CPF+DZN at 24 centigrade, 0.0142 for CPF at 16 centigrade, 0.0151 for DZN at 16 centigrade, and 0.0148 for CPF+DZN, at 16 centigrade. WBPaper00037113:Diazinon_16C_regulated
Fungi infection: Harposporium sp. Genes with decreased expression after 24 hours of infection by Harposporium Fold changes shown are pathogen vs OP50. For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated. WBPaper00038438:Harposporium_24hr_downregulated_RNAseq
  Transcripts that showed differential expression in dauer N2 vs dauer mir-34(gk437) animals at 20C. N.A. WBPaper00050488:N2_vs_mir-34(gk437)_regulated_dauer_20C
  siRNAs that showed significantly lower expression (log2fold > 2, padj < 0.01) in hermaphrodite gonad (somatic gonad plus germine) than in male gonad (somatic gonad plus germine). DESeq2 v1.13.8, fold change > 2, FDR < 0.01. WBPaper00056161:male_enriched_siRNA
Bacteria infection: Enterococcus faecalis Genes with increased expression after 24 hours of infection by E.faecalis Fold changes shown are pathogen vs OP50. For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated. WBPaper00038438:E.faecalis_24hr_upregulated_RNAseq

5 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Also expressed in (comments from author) : PHA phasmid neuron (Thomas Lab 2005) Strain: BC12044 [srg-7::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAGCTTCATTTTCTGATTTCTTGC] 3' and primer B 5' [GCTTGACGCGATCTCTTATGTA] 3'. Expr5309 Adult Expression: intestine; body wall muscle; Nervous System; head neurons; amphids; tail neurons; phasmids; unidentified cells in head; Larval Expression: intestine; body wall muscle; Nervous System; head neurons; amphids; tail neurons; phasmids; unidentified cells in head;  
    Expr2034579 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr1020801 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
    Expr2016355 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr1145007 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  

5 GO Annotation

Annotation Extension Qualifier
  located_in
  located_in
  located_in
  involved_in
  enables

0 Homologues

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00005165 6266484 6268161 -1

5 Ontology Annotations

Annotation Extension Qualifier
  located_in
  located_in
  located_in
  involved_in
  enables

0 Regulates Expr Cluster

1 Sequence

Length
1678

1 Sequence Ontology Term

Identifier Name Description
gene  

2 Strains

WormBase ID
WBStrain00062273
WBStrain00001999

0 Upstream Intergenic Region