WormMine: Gene WBGene00006373

• WormBase Gene ID: WBGene00006373
• Gene Name: syx-5
• Sequence Name: F55A11.2
• Brief Description: syx-5 is an ortholog of human STX5 (syntaxin 5); syx-5 is involved in apoptotic process, embryo development, hermaphrodite genitalia development, locomotion, nematode larval development, positive regulation of growth, receptor-mediated endocytosis, reproduction and secretion by cell; syx-5 is expressed in the pharynx, anal depressor muscle, nervous system, reproductive system, excretory gland cell, and the body wall musculature; at the sub-cellular level, SYX-5::GFP shows a punctate pattern in the epidermis that could correspond to the Golgi apparatus, in addition to a faint pattern highly reminiscent of adherens junctions.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable SNAP receptor activity and SNARE binding activity. Predicted to be involved in intracellular protein transport and vesicle-mediated transport. Predicted to be located in Golgi membrane. Predicted to be part of SNARE complex. Human ortholog(s) of this gene implicated in congenital disorder of glycosylation type II. Is an ortholog of human STX5 (syntaxin 5).
• Biotype: SO:0001217
• Genetic Position: V :3.32983 ±0.001739
• Length (nt): 2319

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00006373

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:F55A11.2.1	F55A11.2.1	1502	V: 11764904-11767222

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:F55A11.2	F55A11.2	1242	V: 11764919-11765107

29 RNAi Result

• WBRNAi00095642
• WBRNAi00081499
• WBRNAi00025644
• WBRNAi00072531
• WBRNAi00074431
• WBRNAi00074437
• WBRNAi00074436
• WBRNAi00085550
• WBRNAi00072532
• WBRNAi00074433
• WBRNAi00074432
• WBRNAi00074435
• WBRNAi00074434
• WBRNAi00032831
• WBRNAi00008864
• WBRNAi00071722
• WBRNAi00094140
• WBRNAi00094272
• WBRNAi00090890
• WBRNAi00071571
• WBRNAi00071572
• WBRNAi00110504
• WBRNAi00072530
• WBRNAi00048408
• WBRNAi00110593
• WBRNAi00081524
• WBRNAi00110495
• WBRNAi00094521
• WBRNAi00069907

29 Allele

• gk963271
• gk963301
• gk964458
• gk964459
• gk964451
• gk964452
• gk963618
• gk964054
• gk964055
• WBVar01866277
• WBVar01866276
• WBVar01974884
• gk595705
• gk677041
• gk883472
• gk512852
• gk853774
• gk761674
• gk342442
• gk743682
• gk356962
• tm3217
• mc51
• mc50
• gk248157
• gk248155
• gk248156
• WBVar00005485
• WBVar00005490

1 Chromosome

• WormBase ID: V
• Organism: Caenorhabditis elegans
• Length (nt): 20924180

1 Chromosome Location

• Feature . Primary Identifier: WBGene00006373
• Start: 11764904
• End: 11767222
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrV_11767223..11767327
• Length (nt): 105
• Chromosome Location: V: 11767223-11767327
• Organism: Caenorhabditis elegans

78 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva fem-3(q20) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-1-adult_vs_L4_upregulated_fem-3(q20)
	Transcripts that showed significantly increased expression in day 3 adult hermaphrodite comparing to in L4 larva fem-3(q20) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_upregulated_fem-3(q20)
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M
	Strictly maternal class (SM): genes that are the subset of maternal genes that are not also classified as embryonic.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_SM
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage.	DESeq	WBPaper00053302:stavudine_24h_regulated
	Proteins that showed significantly decreased expression in 1-day-old sek-1(km4) adults comparing to in wild type animals, both with 6 hours of cisplatin treatment.	The differential expression analysis was performed in R. Differentially expressed proteins were identified by using a two-sided t-test on log-transformed data.	WBPaper00065373:sek-1(km4)_downregulated_cisplatin
	Transcripts detected in germline isolated from day-1 adult hermaphrodite animals.	All three experiments have CPM >= 1.	WBPaper00067147:germline_expressed
	Genes that were not enriched in either spermatogenic fem-3(q96gf) nor oogenic fog-2(q71) gonads, according to RNAseq analysis.	To identify differentially expressed transcripts, authors used R/Bioconductor package DESeq.	WBPaper00045521:Gender_Neutral
	Proteins identified in extracellular vesicle.	N.A.	WBPaper00062669:extracellular-vesicle_protein
	Transcripts that showed decreased expression in hlh-11(ko1) knockout strain comparing to in wild type background.	DESeq2, FDR < 0.05	WBPaper00060683:hlh-11(ko1)_downregulated
Bacteria infection: Enterococcus faecalis OG1RF. Exposure for 16 hours.	Transcripts that showed significantly decreased expression in hpx-2(dg047) after animals were exposed to E. faecalis OG1RF for 16 hours comparing to exposure to E. Coli OP50.	Cuffcompare and Cuffdiff	WBPaper00056090:E.faecalis_downregulated_hpx-2(dg047)
	Genes found to be regulated by low-copy overexpression of sir-2.1 with p < 0.014.	N.A.	WBPaper00026929:sir-2.1_overexpression_regulated
	TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood.	SAM	WBPaper00031040:TGF-beta_adult_downregulated
	Genes expressed in N2.	Expressed transcripts were identified on the basis of a Present call in 3 out of 4 N2 experiments as determined by Affymetrix MAS 5.0.	WBPaper00025141:N2_Expressed_Genes
	Transcripts that showed significantly increased expression in jmjd-3.1p::jmjd-3.1 comparing to in N2.	DESeq2 Benjamini-Hochberg adjusted p-value < 0.05.	WBPaper00049545:jmjd-3.1(+)_upregulated
	Transcripts that showed significantly increased expression in rgef-1p::jmjd-1.2 comparing to in N2.	DESeq2 Benjamini-Hochberg adjusted p-value < 0.05.	WBPaper00049545:rgef-1p-jmjd-1.2(+)_upregulated
	Transcripts that showed significantly increased expression in sur-5p::jmjd-1.2 comparing to in N2.	DESeq2 Benjamini-Hochberg adjusted p-value < 0.05.	WBPaper00049545:sur-5p-jmjd-1.2(+)_upregulated
	Transcripts that showed differential expression in dauer mir-34(gk437) vs dauer mir-34(OverExpression) animals at 20C.	N.A.	WBPaper00050488:mir-34(gk437)_vs_mir-34(OverExpression)_regulated_dauer_20C
	Transcripts that showed significantly decreased expression in pals-22(jy3) comparing to in N2 at L4 larva stage.	Differential expression analysis was performed in RStudio (v1.1.453) using R (v3.50) and Bioconductor (v3.7) packages. As outlined in the RNAseq123 vignette, data was imported, filtered and normalized using edgeR, and linear modeling and differential expression analysis was performed using limma. An FDR cutoff of <0.01 was used to define differentially expressed genes; no fold-change criteria was used.	WBPaper00056034:pals-22(jy3)_downregulated
	Transcripts enriched in germline by comparing dissected germline tissue with dissected intestine tissue, both injected with empty RNAi vector.	Genes were determined germline-enriched if the lowest expression value (log2(FPKM+1)) observed in the germline empty vector samples was at least 2-fold higher than the highest expression value observed in the intestine empty vector samples.	WBPaper00051039:germline_enriched
	Transcripts that showed significantly decreased expression in sek-1(km4) animals comparing to in N2 animals under both dietary (DR, OP50 OD = 0.1) and ad libtum (AL, OP50 OD = 3) conditions from 3-day post L4 till 6-day post L4 adult hermaphrodite stage.	Bioconductor package edgeR, p < 0.05.	WBPaper00056443:sek-1(km4)_downregulated
Bacteria infection: Xenorhabdus nematophila	Caenorhabditis elegans Genes with expression levels changed significantly after treatment of Xenorhabdus nematophila.	Differential expression were calculated by empirical eBayes method using eBayes function. P_value <= 0.01 and log2 fold change > 1 were used to call differentially expressed genes in all datasets.	WBPaper00041606:CE_X.nematophila_regulated
control(maintained under normal lab light (mostly dark, in incubators).) vs EtBr-exposed(maintained under normal lab light (mostly dark, in incubators) and exposed to EtBr (5ug/mL in agar).) at just prior to the third UVC dose (48h).	Genes differentially expressed in control vs under EtBr treatment without UVC exposure, at the -1h timepoint.	Transcripts were defined as fold-change >1.2, p < 0.05 based on Rosetta Resolver analysis for all pairwise treatment comparisons. The fold-change refers to the second intensity over the first.	WBPaper00041939:control_vs_EtBr-exposed_48h
control(maintained under normal lab light (mostly dark, in incubators).) vs UVC-EtBr-exposed(exposed to 7.5 J/m2 UVC radiation 3 times, 24 h apart (48 h total) and exposed to EtBr (5ug/mL in agar).) at just prior to the third UVC dose (48h).	Genes differentially expressed in control vs after UVC exposure and EtBr treatment at the -1h timepoint (just prior to the third UVC dose (48h)).	Transcripts were defined as fold-change >1.2, p < 0.05 based on Rosetta Resolver analysis for all pairwise treatment comparisons. The fold-change refers to the second intensity over the first.	WBPaper00041939:control_vs_UVC-EtBr-exposed_48h

8 Expression Patterns

• Primary Identifier: Expr2035331
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr6188
• Remark: Also expressed in (comments from author) : No comments. Strain: BC15905
• Reporter Gene: [syn-3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAACAGCATCAACAAGTCTCTCTG] 3' and primer B 5' [CGACATCGAACAAACTGAAAAA] 3'.
• Pattern: Adult Expression: pharynx; anal depressor muscle; Reproductive System; vulva other; body wall muscle; excretory gland cells; Nervous System; head neurons; tail neurons; Larval Expression: pharynx; anal depressor muscle; body wall muscle; excretory gland cells; Nervous System; head neurons; tail neurons

• Primary Identifier: Expr1032571
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr12505
• Subcellular Localization: SYX-5 localizes in large round structures potentially corresponding to the epidermal Golgi apparatus. In addition, more discrete puncta were observed localizing at the most apical side of the epidermis. These puncta occasionally colocalized with VHA-5. SYX-5 colocalizes with a constitutively active form of RAL-1 at the plasma membrane.

• Primary Identifier: Expr1152197
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Chronogram721
• Remark: Original chronogram file: chronogram.1752.xml
• Reporter Gene: [F55A11.2:gfp] transcriptional fusion.

• Primary Identifier: Expr2017195
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1016887
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

19 GO Annotation

6 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00006373
• Start: 11764904
• End: 11767222
• Strand: 1

19 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 2319

1 Sequence Ontology Term

• Name: gene

1 Strains

• WBStrain00003671

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrV_11764386..11764903
• Length (nt): 518
• Chromosome Location: V: 11764386-11764903
• Organism: Caenorhabditis elegans