WormMine: Gene WBGene00006446

• WormBase Gene ID: WBGene00006446
• Gene Name: atx-3
• Sequence Name: F28F8.6
• Brief Description: atx-3 encodes a deubiquitylating enzyme that is the C. elegans ortholog of human ataxin-3 (ATXN3); atx-3 deletion mutants show no overt phenotype, but loss of atx-3 activity via RNAi has been reported to result in 10-25% embryonic lethality; however, microarray experiments comparing wild-type and atx-3 mutant strains indicate that loss of atx-3 activity results in expression changes in genes involved in the ubiquitin-proteasome pathway, signal transduction, and cell structure and motility; ATX-3 exhibits deubiquitinating (DUB) activity against polyubiquitin chains in vitro; an ATX-3::GFP reporter is expressed throughout the life cycle in a number of different tissues, with adults showing stronger expression than larvae or eggs; ATX-3::GFP localizes to both the nucleus and the cytoplasm, with higher levels found in the cytoplasm.
• Organism: Caenorhabditis elegans
• Automated Description: Enables cysteine-type deubiquitinase activity. Involved in chemical synaptic transmission. Located in cytoplasm and nucleus. Expressed in coelomocyte; head; somatic nervous system; and tail neurons. Used to study Machado-Joseph disease. Human ortholog(s) of this gene implicated in Machado-Joseph disease and late onset Parkinson's disease. Is an ortholog of human ATXN3 (ataxin 3) and ATXN3L (ataxin 3 like).
• Biotype: SO:0001217
• Genetic Position: V :8.39281 ±0.005185
• Length (nt): 1948

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00006446

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:F28F8.6.1	F28F8.6.1	1264	V: 15575498-15577443
Transcript:F28F8.6.2	F28F8.6.2	1147	V: 15575498-15576887
Transcript:F28F8.6.3	F28F8.6.3	1652	V: 15575502-15577445

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:F28F8.6	F28F8.6	954	V: 15575682-15576166

6 RNAi Result

• WBRNAi00094701
• WBRNAi00045852
• WBRNAi00077833
• WBRNAi00031535
• WBRNAi00082468
• WBRNAi00007736

60 Allele

• gk963271
• gk963301
• gk964458
• gk964459
• gk964389
• WBVar01975809
• WBVar01828626
• WBVar01828627
• WBVar01828628
• WBVar01828629
• WBVar01828625
• WBVar01828633
• WBVar01828634
• WBVar01828635
• WBVar01828630
• WBVar01828631
• WBVar01828632
• gk193
• tm12064
• gk256106
• gk256105
• gk256104
• gk256103
• h10130
• gk256102
• tm1689
• WBVar01745452
• WBVar01800444
• WBVar02032223
• WBVar01463495

1 Chromosome

• WormBase ID: V
• Organism: Caenorhabditis elegans
• Length (nt): 20924180

1 Chromosome Location

• Feature . Primary Identifier: WBGene00006446
• Start: 15575498
• End: 15577445
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrV_15575406..15575497
• Length (nt): 92
• Chromosome Location: V: 15575406-15575497
• Organism: Caenorhabditis elegans

116 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Genes that were upregulated in lin-15B(n744).	For each gene in each microarray hybridization experiment, the ratio of RNA levels from the two samples was transformed into a log2 value and the mean log2 ratio was calculated. The log2 ratios were normalized by print-tip Loess normalization (Dudoit and Yang, 2002). All genes with a false discovery rate of <= 5% (q <= 0.05) (Storey and Tibshirani, 2003) and a mean fold-change ratio of >= 1.5 were selected for further analysis.	WBPaper00038168:lin-15B(n744)_upregulated
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva fem-3(q20) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-1-adult_vs_L4_upregulated_fem-3(q20)
	Transcripts that showed significantly increased expression in day 3 adult hermaphrodite comparing to in L4 larva fem-3(q20) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_upregulated_fem-3(q20)
Bacteria diet: Escherichia coli HB101. Fed for 30 generations.	Transcripts that showed significantly decreased expression after fed by bacteria E. coli HB101 for 30 generations comparing to animals fed by E. coli OP50.	DESeq2 fold change > 2, p-value < 0.01.	WBPaper00061007:HB101_downregulated
Bacteria diet: Sphingomonas aquatilis Yellow. Fed for 30 generations.	Transcripts that showed significantly decreased expression after fed by bacteria Sphingomonas aquatilis (Yellow) for 30 generations comparing to animals fed by E. coli OP50.	DESeq2 fold change > 2, p-value < 0.01.	WBPaper00061007:S.aquatilis_downregulated
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M
	Strictly maternal class (SM): genes that are the subset of maternal genes that are not also classified as embryonic.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_SM
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage.	DESeq	WBPaper00053302:stavudine_24h_regulated
	Transcripts that showed differential expression between 24 and 26 hours post hatching L2d and dauer committed larvae of daf-9(dh6), triggered by the dafachronic acid (DA) growth hormone. Cluster 3 genes increased expression transiently at 26 hour post hatching.	Benjamini Hochberg corrected q-value < 0.01.	WBPaper00053388:dauer_regulated_Cluster3
25C vs. 20C	Transcripts that showed significantly increased expression in 1-day post L4 adult hermaphrodite N2 grown at 25C, comparing to in N2 animals grown at 20C.	CuffDiff, fold change > 2.	WBPaper00065096:25C_vs_20C_upregulated
	Transcripts that showed significantly increased expression in 10-days post L4 adult hermaphrodite N2 grown at 20C, comparing to in 1-day post L4 adult hermaphrodite N2 animals grown at 20C.	CuffDiff, fold change > 2.	WBPaper00065096:Day10_vs_Day1_upregulated
	Genes with increased RNA expression after 24 hours rotenone treatment	EdgeR provides statistical routines for determining differential expression in digital gene expression data using a model based on the negative binomial distribution. The resulting p-values were adjusted using the Benjamini and Hochbergs approach for controlling the false discovery rate (FDR). Transcripts with an adjusted p-value smaller 0.05 were assigned as differentially expressed.	WBPaper00044426:rotenone_24h_upregulated
	Transcripts that showed significantly decreased expression in tetraploid N2 comparing to diploid N2 animals at L4 larva stage.	DESeq2 R package (1.20.0), fold change > 2, and FDR < 0.05.	WBPaper00066110:tetraploid_vs_diploid_downregulated
	Transcripts detected in germline isolated from day-1 adult hermaphrodite animals.	All three experiments have CPM >= 1.	WBPaper00067147:germline_expressed
	Genes that were not enriched in either spermatogenic fem-3(q96gf) nor oogenic fog-2(q71) gonads, according to RNAseq analysis.	To identify differentially expressed transcripts, authors used R/Bioconductor package DESeq.	WBPaper00045521:Gender_Neutral
	Transcripts that showed altered expression from P0 to F2 generation animals after N2 parental generation were treated with antimycin, but not in damt-1(gk961032) P0 to F2 animals after the parenal generaton were treated with antimycin.	N.A.	WBPaper00055862:antimycin_damt-1(gk961032)_regulated
	Transcripts that showed significantly decreased expression in nhl-2(ok818) comparing to in N2 at 25C.	EdgeR, FDR < 0.05, fold change < 0.5.	WBPaper00055971:nhl-2(ok818)_25C_upregulated
	Transcripts that showed decreased expression in hlh-11(ko1) knockout strain comparing to in wild type background.	DESeq2, FDR < 0.05	WBPaper00060683:hlh-11(ko1)_downregulated
Bacteria infection: Enterococcus faecalis OG1RF. Exposure for 16 hours.	Transcripts that showed significantly decreased expression in hpx-2(dg047) after animals were exposed to E. faecalis OG1RF for 16 hours comparing to exposure to E. Coli OP50.	Cuffcompare and Cuffdiff	WBPaper00056090:E.faecalis_downregulated_hpx-2(dg047)
	Germline-intrinsic transcripts.	Comparisons were made between genotypes by subtracting the mean log value of one ratio from another, and the significance of the difference was evaluated using Student t-test for two populations. For the fem-3(gf) versus fem-1(lf) direct comparison, authors performed the same analysis, except they used a Students t-test for one population. Author chose a combination of a twofold difference with a t value exceeding 99% confidence (P < 0.01), because these criteria allowed the inclusion of essentially all genes that had previously been identified as germline-enriched in a wt/glp-4 hermaphrodite comparison. Additionally, requiring a twofold difference reduced false positives, as the number of genes with two-fold difference and a P<0.01 only included ~100 genes more than with P < 0.001, and almost all genes showed germline expression by in situ hybridization.	[cgc6390]:intrinsic

10 Expression Patterns

• Primary Identifier: Expr4767
• Pattern: Young embryos did not present a GFP signal, but expression was observed in late embryogenesis and at all stages of postnatal development: eggs, L1, L2, L3, L4, and adults. Adult animals showed stronger expression than did larval stages and eggs; this was also proved by RT-polymerase chain reaction (RT-PCR), suggesting potential developmental dynamics in atx-3 function. Both transgenic strains had a generalized expression pattern, with a strong signal in the spermatheca and vulval muscle . High fluorescence was observed in neuronal dorsal and ventral cord and neurons of the head and tail. Expression was also observed in the hypoderm, body muscles, and coelomocytes.

• Primary Identifier: Expr2009521
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr5910
• Remark: Also expressed in (comments from author) : Very mosaic strain, with low intensity GFP. Strain: BC11021
• Reporter Gene: [atx-3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATGATGCAAAAATAAACCATTCG] 3' and primer B 5' [TTGGAGCTGGAAAAATTTGG] 3'.
• Pattern: Adult Expression: pharynx; intestine; Reproductive System; vulva other; spermatheca; body wall muscle; hypodermis; seam cells; unidentified cells in head; Larval Expression: pharynx; intestine; Reproductive System; developing vulva; body wall muscle; hypodermis; seam cells; unidentified cells in head

• Primary Identifier: Expr5909
• Remark: Strain: BC14364
• Reporter Gene: [atx-3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATGATGCAAAAATAAACCATTCG] 3' and primer B 5' [TTGGAGCTGGAAAAATTTGG] 3'.
• Pattern: Adult Expression: pharynx; Reproductive System; vulval muscle; spermatheca; hypodermis; seam cells; Larval Expression: pharynx; hypodermis; seam cells

• Primary Identifier: Expr1019245
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Chronogram20
• Remark: Original chronogram file: chronogram.1015.xml
• Reporter Gene: [F28F8.6:gfp] transcriptional fusion.

• Primary Identifier: Expr1032624
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr2027758
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Chronogram2079
• Remark: Original chronogram file: chronogram.994.xml
• Reporter Gene: [F28F8.6:gfp] transcriptional fusion.

• Primary Identifier: Expr1149757
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

23 GO Annotation

4 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00006446
• Start: 15575498
• End: 15577445
• Strand: -1

23 Ontology Annotations

4 Regulates Expr Cluster

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Genes that showed significantly increased expression in both atx-3(gk193) and atx-3(tm1689) comparing with N2.	Differentially expressed (DE) genes were selected using a Bayesian approach with a false discovery rate of 0.1%.	WBPaper00029047:atx-3_upregulated
	Genes that showed significantly decreased expression in both atx-3(gk193) and atx-3(tm1689) comparing with N2.	Differentially expressed (DE) genes were selected using a Bayesian approach with a false discovery rate of 0.1%.	WBPaper00029047:atx-3_downregulated
	Proteins that changed expression level after heat shock in atx-3(gk193) and atx-3(tm1689) comparing to N2.	A 5% peptide false positive rate was chosen and only proteins identified by two or more peptides were selected.	WBPaper00038357:atx-3_regulated_heat-shock
	Proteins that changed expression level at basal level in atx-3(gk193) and atx-3(tm1689) comparing to N2.	A 5% peptide false positive rate was chosen and only proteins identified by two or more peptides were selected.	WBPaper00038357:atx-3_regulated_basal

1 Sequence

• Length: 1948

1 Sequence Ontology Term

• Name: gene

4 Strains

• WBStrain00026428
• WBStrain00035696
• WBStrain00001592
• WBStrain00002998

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrV_15577446..15577493
• Length (nt): 48
• Chromosome Location: V: 15577446-15577493
• Organism: Caenorhabditis elegans