WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00005855 Gene Name  srw-108
Sequence Name  ? R11G11.5 Organism  Caenorhabditis elegans
Automated Description  Predicted to enable G protein-coupled peptide receptor activity. Predicted to be involved in G protein-coupled receptor signaling pathway. Predicted to be located in membrane. Expressed in ASKL; ASKR; and anterior hypodermis. Biotype  SO:0001217
Genetic Position  V :-19.9815± Length (nt)  ? 968
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00005855

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:R11G11.5.1 R11G11.5.1 591   V: 527902-528869
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:R11G11.5 R11G11.5 591   V: 527902-527954

4 RNAi Result

WormBase ID
WBRNAi00051815
WBRNAi00017774
WBRNAi00034871
WBRNAi00103487

70 Allele

Public Name
gk963591
gk964259
gk963850
gk963027
gk963889
gk962552
gk962551
WBVar02122151
WBVar02124605
gk963767
gk963768
WBVar02123844
WBVar02122634
WBVar02121233
WBVar02120511
WBVar00200884
WBVar00200885
WBVar00200886
WBVar00200887
WBVar00200888
WBVar00200889
WBVar00200890
WBVar02122833
gk356006
gk484506
gk776540
gk333867
gk361959
WBVar01583493
WBVar01583484

1 Chromosome

WormBase ID Organism Length (nt)
V Caenorhabditis elegans 20924180  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00005855 527902 528869 1

3 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  

1 Downstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrV_528870..529276   407 V: 528870-529276 Caenorhabditis elegans

17 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
  mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis. Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05. WBPaper00045420:fertilization_downregulated_transcript
  Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology. DESEQ2, fold change > 2 and FDR < 0.01. WBPaper00062103:neuron_enriched
Reduced humidity (98% relative humidity). Genes that were down-regulated after one day exposure to reduced humidity (98% relative humidity) according to microarray analysis. Multiple hypothesis testing with the Benjamini-Hochberg correction was applied on calculated p-values. A change in the expression level was considered to be significant if the adjusted p-value was less than 0.001. WBPaper00044578:reduced-humidity_downregulated_microarray
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:bodywall-muscle_L2-larva_expressed
  Transcripts that showed differential expression in dauer mir-34(gk437) vs dauer mir-34(OverExpression) animals at 20C. N.A. WBPaper00050488:mir-34(gk437)_vs_mir-34(OverExpression)_regulated_dauer_20C
  Genome-wide analysis of developmental and sex-regulated gene expression profile. self-organizing map cgc4489_group_11
  Genes that showed significant differential expressed between control and 20 mg\/L Cadmium treatment. t-test, p < 0.05. WBPaper00036123:Cadmium_regulated
  Genes in the bottom 10% of expression level across the triplicate L3 samples. To generate the top10 and bottom10 gene sets, authors ranked all genes by mean expression array signal intensity across the three replicates, then took the top and bottom deciles (1,841 genes each) to represent genes with high and low expression. To generate the top10 and bottom10 gene sets, authors ranked all genes by mean expression array signal intensity across the three replicates, then took the top and bottom deciles (1,841 genes each) to represent genes with high and low expression. WBPaper00032528:L3_depleted
  Potental DAF-12 target genes identified by ChIP-chip analysis performed on strain ALF4 [daf-12 Affymetrix TAS software that computed for each probe estimates of fold enrichment (in linear scale) over hybridization with input DNA. At the same time, TAS calculated for each probe a p-value by applying a Wilcoxon signed rank test. A threshold of 2.5 was selected, which corresponds to probe intensities approximately 2.5 times stronger on the ChIP array than on the Input array. Additional TAS threshold parameters were MinRun=180 bp, MaxGap=300 bp. TAS analysis showed that the selected threshold of 2.5 corresponds approximately to a p-value of 0.01. WBPaper00040221:DAF-12_target_ALF4
Bacteria Diet: L. plantarum with pdxH mutant vs. L. plantarum Transcripts that showed significantly increased expression in N2 animals fed with L. plantarum with pdxH mutant, comparing to in N2 animals fed with L. plantarum. GFold3, logFC < -1 or > 1. WBPaper00066703:L.plantarum-pdxH_upregulated
  Coexpression clique No. 211, srj-42-srw-113, on the genome-wide coexpression clique map for the nematode GPL200 platform. All available microarray datasets for the GPL200 platform (Affymetrix C. elegans Genome Array) were obtained from the GEO repository. This included 2243 individual microarray experiments. These were normalized against each other with the software RMAexpress (Bolstad, 2014). Based on these normalized values, Pearsons correlation coefficients were obtained for each probe-probe pair of the 22,620 probes represented on this array type. The resulting list of correlation coefficients was then ranked to generate the ranked coexpression database with information on each probe represented on the GPL200 platform. WBPaper00061527:srj-42-srw-113
  Transcripts that showed significantly increased expression in drh-3(rrr2) comparing to in N2. edgeR, log2 fold change > 2 or < -2. WBPaper00053888:drh-3(rrr2)_upregulated
  Genes up regulated in the absence of TDP-1, when the threshold was set at a fold change (FC) of 1.2. The management and statistical analysis of the microarray data were performed using the Partek Genomic Suite (Partek, Missouri) and Spotfire DecisionSite software (TIBCO, California). WBPaper00040603:tdp-1(lf)_up_vs_N2_FC_1.2
  Transcripts that showed lower expression in neurons isolated from male day 2 vs day 8. DESeq2 analysis was then employed for read normalization and differential expression analysis of the counted reads. PCA analysiswas performed along with the DESeq2 package. Genes with a log2(fold-change) > 1 and p-adjusted < 0.05 were considered differentially expressed in subsequent analysis. WBPaper00066831:male-neuron_aging_upregulated
  Genes with more than 1.4 fold increase of expression after exposing to 16mg/l aldicarb Data filtering based on a cut-off of 1.4 fold change in expression revealed 8,282 aldicarb responsive genes (4,960 up-regulated, 3,322 down-regulated). Statistical analysis of this set of fold change filtered genes using T-test with Benjamini and Hochberg false discovery correction identified 380 significant up-regulated genes and 282 significant down-regulated genes. WBPaper00038061:aldicarb_upregulated
  Potental DAF-12 target genes identified by ChIP-chip analysis performed on strain ALF9 [daf-12 Affymetrix TAS software that computed for each probe estimates of fold enrichment (in linear scale) over hybridization with input DNA. At the same time, TAS calculated for each probe a p-value by applying a Wilcoxon signed rank test. A threshold of 2.5 was selected, which corresponds to probe intensities approximately 2.5 times stronger on the ChIP array than on the Input array. Additional TAS threshold parameters were MinRun=180 bp, MaxGap=300 bp. TAS analysis showed that the selected threshold of 2.5 corresponds approximately to a p-value of 0.01. WBPaper00040221:DAF-12_target_ALF9

4 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Also expressed in (comments from author) : No comments. Strain: BC15940 [srw-108::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATCCCAAGTGCAGCAAAAAT] 3' and primer B 5' [TCGAAATAGCTTATCAACAAATCT] 3'. Expr6509 Adult Expression: Nervous System; head neurons; amphids; Larval Expression: Nervous System; head neurons; amphids;  
Other Strain: OH14759   Expr14171 ASK, head hypodermis  
    Expr1155475 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  
    Expr1010221 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

3 GO Annotation

Annotation Extension Qualifier
  located_in
  involved_in
  enables

0 Homologues

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00005855 527902 528869 1

3 Ontology Annotations

Annotation Extension Qualifier
  located_in
  involved_in
  enables

0 Regulates Expr Cluster

1 Sequence

Length
968

1 Sequence Ontology Term

Identifier Name Description
gene  

1 Strains

WormBase ID
WBStrain00062364

1 Upstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrV_526692..527901   1210 V: 526692-527901 Caenorhabditis elegans