WormMine: Gene WBGene00006701

• WormBase Gene ID: WBGene00006701
• Gene Name: ubc-1
• Sequence Name: C35B1.1
• Brief Description: ubc-1 encodes an E2 ubiquitin-conjugating enzyme that contains a novel 40 amino acid C-terminal tail, and is homologous to Saccharomyces cerevisiae RAD6/UBC2 which is involved in DNA repair; although loss of UBC-1 activity via RNA-mediated interference (RNAi) does not result in any abnormalities, UBC-1 is able to complement the DNA repair defects of a Saccharomyces cerevisiae rad6 null mutant, suggesting that UBC-1 can function in the DNA repair pathway; ubc-1 mRNA is detectable in embryos.
• Organism: Caenorhabditis elegans
• Automated Description: Enables ubiquitin conjugating enzyme activity and ubiquitin protein ligase binding activity. Involved in DNA repair and protein ubiquitination. Part of ubiquitin conjugating enzyme complex. Expressed in head and tail. Human ortholog(s) of this gene implicated in syndromic X-linked intellectual disability Nascimento type. Is an ortholog of human UBE2B (ubiquitin conjugating enzyme E2 B).
• Biotype: SO:0001217
• Genetic Position: IV :-0.691908 ±0.031774
• Length (nt): 3244

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00006701

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:C35B1.1.1	C35B1.1.1	1676	IV: 4103020-4106263

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:C35B1.1	C35B1.1	579	IV: 4103036-4103086

25 RNAi Result

• WBRNAi00073978
• WBRNAi00073979
• WBRNAi00073980
• WBRNAi00073981
• WBRNAi00073982
• WBRNAi00073983
• WBRNAi00073984
• WBRNAi00073985
• WBRNAi00041954
• WBRNAi00072368
• WBRNAi00072370
• WBRNAi00011645
• WBRNAi00076198
• WBRNAi00082817
• WBRNAi00072369
• WBRNAi00063533
• WBRNAi00063534
• WBRNAi00063535
• WBRNAi00063536
• WBRNAi00063538
• WBRNAi00063540
• WBRNAi00063542
• WBRNAi00117658
• WBRNAi00064410
• WBRNAi00029565

42 Allele

• gk963722
• gk963908
• WBVar02069809
• WBVar02069810
• WBVar02069811
• WBVar02122953
• gk963335
• WBVar00188448
• WBVar00188449
• WBVar00188450
• WBVar01990819
• gk199439
• gk199437
• WBVar01923093
• gk199438
• WBVar01568611
• WBVar01568610
• WBVar01923092
• WBVar01568609
• WBVar01568608
• WBVar01904350
• WBVar01452066
• WBVar01452065
• WBVar01853424
• WBVar01831795
• WBVar01452067
• gk334244
• WBVar01953646
• gk619702
• gk590533

1 Chromosome

• WormBase ID: IV
• Organism: Caenorhabditis elegans
• Length (nt): 17493829

1 Chromosome Location

• Feature . Primary Identifier: WBGene00006701
• Start: 4103020
• End: 4106263
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrIV_4106264..4106573
• Length (nt): 310
• Chromosome Location: IV: 4106264-4106573
• Organism: Caenorhabditis elegans

101 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
	Transcripts that showed significantly increased expression in oocyte germline cells comparing to in mitosis germline cells.	Log2 Fold change > 2 or <-1, p-value < 0.05.	WBPaper00053599:oocyte_vs_mitosis_upregulated
Bacteria infection: Staphylococcus aureus	mRNAs that showed increased expression 8 hours after N2 animals were infected by S. aureus.	DESeq, p <= 0.05	WBPaper00045314:S.aureus-induced_N2
	Transcriptions that showed significantly increased expression in skn-1(RNAi) comparing to empty vector injection into rrf-3(pk1426);daf-2(e1368) animals.	Genes with an absolute fold changeof at least 2 and standard p-values below 0.05 were considered as differentially expressed.	WBPaper00062193:skn-1(RNAi)_upregulated
	Transcripts detected in germline isolated from day-1 adult hermaphrodite animals.	All three experiments have CPM >= 1.	WBPaper00067147:germline_expressed
	Genes that were not enriched in either spermatogenic fem-3(q96gf) nor oogenic fog-2(q71) gonads, according to RNAseq analysis.	To identify differentially expressed transcripts, authors used R/Bioconductor package DESeq.	WBPaper00045521:Gender_Neutral
	Transcripts that showed significantly increased expression after N2 animals were exposed to BL21 bacteria carrying pET28a-cry5B, comparing to animals exposed to BL21 control bacteria.	Differentially expressed genes were identified through fold change as well as P value calculated with t-test. The threshold set for up- and down-regulated genes was a fold change >= 2.0 and a P value <= 0.05.	WBPaper00065732:Cry5Ba_upregulated_N2
Starvation 48 hours at L1 arrest	Transcripts that showed significantly increased expression in starved N2 animals (48 hours at L1 arrest)	Fold change > 2.	WBPaper00064005:starvation_upregulated_N2_mRNA
	Transcripts of coding genes that showed significantly increased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_enriched_coding-RNA
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2 at early embryo stage.	DESeq2, FDR < 0.05	WBPaper00058691:sin-3(tm1276)_upregulated
	Transcripts that showed significantly increased expression in set-2(zr2012) animals at embryo stage, comparing to in N2 animals.	DESeq2 (v2.1.8.3) was used to determine DE genes and to generate principal component and scatter plots. DE genes with FDR < 0.05 were analysed using g:Profiler with Bonferroni correction.	WBPaper00060014:set-2(zr2012)_upregulated
	Transcripts that showed significantly increased expression in WD61[kri-1(ok1251)] comparing to in N2.	N.A.	WBPaper00056586:kri-1(ok1251)_upregulated
UVC-EtBr-exposed(exposed to 7.5 J/m2 UVC radiation 3 times, 24 h apart (48 h total) and exposed to EtBr (5ug/mL in agar).) vs EtBr-exposed(maintained under normal lab light (mostly dark, in incubators) and exposed to EtBr (5ug/mL in agar).) at just prior to the second UVC dose (24h).	Genes differentially expressed under UVC exposure and EtBr treatment vs under EtBr treatment but without UVC exposure at the -25h timepoint (just prior to the second UVC dose (24h)).	Transcripts were defined as fold-change >1.2, p < 0.05 based on Rosetta Resolver analysis for all pairwise treatment comparisons. The fold-change refers to the second intensity over the first.	WBPaper00041939:UVC-EtBr-exposed_vs_EtBr-exposed_24h
	Transcripts that showed significantly increased expression in emb-4(hc60) comparing to in N2.	DESeq2	WBPaper00052884:emb-4(hc60)_upregulated
	Transcripts that showed significantly increased expression in sma-4(rax3) comparing to in N2 at 1-day post-L4 adult hermaphrodite	HTseq-count was used to count reads mapped to each gene and counting data was imported to EdgeR for statistical analysis. Statistical significance was defined by adjusted P value (false discovery rate, FDR) of <0.05.	WBPaper00053184:sma-4(rax3)_upregulated
	Transcripts that showed differential expression between 24 and 26 hours post hatching L2d and dauer committed larvae of daf-9(dh, triggered by the dafachronic acid (DA) growth hormone6). Cluster 2 genes' expression gradually increased into dauer.	Benjamini Hochberg corrected q-value < 0.01.	WBPaper00053388:dauer_regulated_Cluster2
Bacteria infection: Pseudomonas aeruginosa PA14. 24 hours of exposure at 25C.	Transcripts that showed significantly decreased expression in N2 animals with 24 hours of exposure to P. aeruginosa PA14 for 24 hrs at 25C, comparing to N2 animals without exposure to PA14.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00058948:PA14_downregulated
	Transcripts that showed significantly increased expression in jmjd-3.1p::jmjd-3.1 comparing to in N2.	DESeq2 Benjamini-Hochberg adjusted p-value < 0.05.	WBPaper00049545:jmjd-3.1(+)_upregulated
	Transcripts that showed significantly increased expression in rgef-1p::jmjd-1.2 comparing to in N2.	DESeq2 Benjamini-Hochberg adjusted p-value < 0.05.	WBPaper00049545:rgef-1p-jmjd-1.2(+)_upregulated
control(maintained under normal lab light (mostly dark, in incubators).) vs UVC-EtBr-exposed(exposed to 7.5 J/m2 UVC radiation 3 times, 24 h apart (48 h total) and exposed to EtBr (5ug/mL in agar).) at just prior to the second UVC dose (24h).	Genes differentially expressed in control vs after UVC exposure and EtBr treatment at the -25h timepoint (just prior to the second UVC dose (24h)).	Transcripts were defined as fold-change >1.2, p < 0.05 based on Rosetta Resolver analysis for all pairwise treatment comparisons. The fold-change refers to the second intensity over the first.	WBPaper00041939:control_vs_UVC-EtBr-exposed_24h

8 Expression Patterns

• Primary Identifier: Expr2035844
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr5430
• Remark: Strain: BC12736
• Reporter Gene: [ubc-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCGACGATGATATTAGTCCAGAAA] 3' and primer B 5' [TGGGCGTCGTGATATTGAT] 3'.
• Pattern: Adult Expression: intestine; Nervous System; head neurons; Larval Expression: intestine; Nervous System; head neurons

• Primary Identifier: Expr5431
• Remark: Also expressed in (comments from author) : unidentified cells in head and tail, neural. Strain: BC12994
• Reporter Gene: [ubc-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCGACGATGATATTAGTCCAGAAA] 3' and primer B 5' [TGGGCGTCGTGATATTGAT] 3'.
• Pattern: Adult Expression: intestine; hypodermis; seam cells; Nervous System; head neurons; neurons along body; PVT interneuron; tail neurons; unidentified cells in head; unidentified cells in tail ; Larval Expression: intestine; rectal gland cells; hypodermis; seam cells; Nervous System; head neurons; neurons along body; PVT interneuron; tail neurons; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr1032784
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr1145963
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr2017706
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1018771
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Chronogram1685
• Remark: Original chronogram file: chronogram.606.xml
• Reporter Gene: [C35B1.1:gfp] transcriptional fusion.

23 GO Annotation

11 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00006701
• Start: 4103020
• End: 4106263
• Strand: 1

23 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 3244

1 Sequence Ontology Term

• Name: gene

3 Strains

• WBStrain00055625
• WBStrain00002440
• WBStrain00002286

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrIV_4102908..4103019
• Length (nt): 112
• Chromosome Location: IV: 4102908-4103019
• Organism: Caenorhabditis elegans