WormMine: Gene WBGene00006917

• WormBase Gene ID: WBGene00006917
• Gene Name: vha-8
• Sequence Name: C17H12.14
• Brief Description: vha-8 encodes an ortholog of subunit E of the cytoplasmic (V1) domain ofvacuolar proton-translocating ATPase (V-ATPase); VHA-8 is a predictedcytosolic stator (stalk) component; VHA-8 is required for embryonic andlarval viability, for ovulation, and for receptor-mediated endocytosisof yolk protein; VHA-8 is highly expressed in the cytoplasm of excretorycanals throughout development, and in the stacked apical plasma membranesheets of syncytial hypodermal cells; general levels of VHA-8 proteinare very low in embryos but increase strongly after hatching; vha-8mutants show necrotic cell death in hypodermis and intestine,paralleling the role of VHA-12 and other V-ATPase subunits in neuronalnecrosis; VHA-8 is dispensable for alae formation, like the V1 subunitVHA-13, but not like the V0 subunits VHA-1 and VHA-4.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable proton-transporting ATPase activity, rotational mechanism. Predicted to be involved in proton transmembrane transport. Located in apical plasma membrane and cytoplasm. Expressed in head; hypodermis; and intestine. Human ortholog(s) of this gene implicated in autosomal recessive cutis laxa type IIC. Is an ortholog of human ATP6V1E2 (ATPase H+ transporting V1 subunit E2).
• Biotype: SO:0001217
• Genetic Position: IV :3.23455 ±0.001195
• Length (nt): 1382

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00006917

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:C17H12.14.1	C17H12.14.1	1134	IV: 6791074-6792455

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:C17H12.14	C17H12.14	681	IV: 6791098-6791223

36 RNAi Result

• WBRNAi00095498
• WBRNAi00066771
• WBRNAi00085560
• WBRNAi00040864
• WBRNAi00062968
• WBRNAi00062969
• WBRNAi00116379
• WBRNAi00071710
• WBRNAi00080714
• WBRNAi00106551
• WBRNAi00094148
• WBRNAi00094276
• WBRNAi00065031
• WBRNAi00090869
• WBRNAi00091161
• WBRNAi00091160
• WBRNAi00084624
• WBRNAi00103023
• WBRNAi00071418
• WBRNAi00103004
• WBRNAi00029033
• WBRNAi00062973
• WBRNAi00024587
• WBRNAi00084625
• WBRNAi00103003
• WBRNAi00008416
• WBRNAi00062972
• WBRNAi00062970
• WBRNAi00062971
• WBRNAi00110591

16 Allele

• gk964500
• gk963722
• gk963417
• gk963416
• gk408413
• gk858648
• gk780890
• gk541721
• gk548633
• gk495430
• gk793031
• gk756844
• WBVar01913424
• WBVar01516273
• WBVar01569723
• jh135

1 Chromosome

• WormBase ID: IV
• Organism: Caenorhabditis elegans
• Length (nt): 17493829

1 Chromosome Location

• Feature . Primary Identifier: WBGene00006917
• Start: 6791074
• End: 6792455
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrIV_6792456..6792973
• Length (nt): 518
• Chromosome Location: IV: 6792456-6792973
• Organism: Caenorhabditis elegans

151 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	oocyte proteins identified by two or more unique peptides during proteomics study.	In the pooled data set, 1453 C. elegans proteins were identified with a probability >= 0.9 according to ProteinProphet, of which 1165 proteins were identified by more than one unique peptide.	WBPaper00038289:oocyte_protein
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
	TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood.	SAM	WBPaper00031040:TGF-beta_adult_upregulated
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts that showed significantly decreased expression in atfs-1(cmh15) (null allele) animals comparing to in N2 animals at L4 larva stage.	edgeR, fold change > 2, FDR < 0.05	WBPaper00060909:atfs-1(cmh15)_downregulated
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
Bacteria infection: Bacillus thuringiensis	Transcripts that showed significantly increased expression in N2 animals infected by bacteria BMB171/Cry5Ba, an acrystalliferous Bt mutant BMB171 transformed with toxin gene cry5Ba on the shuttle vector pHT304, comparing to N2 animals infected by BMB171/pHT304.	N.A.	WBPaper00064229:B.thuringiensis-Cry5Ba_upregulated
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
	Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage.	DESeq2 version 1.22.2, p < 0.05	WBPaper00064716:paraquat_downregulated
	Transcripts that showed significantly changed expression in 6-day post-L4 adult hermaphrodite comparing to in 1-day post L4 adult hermaphrodite animals.	Sleuth	WBPaper00051558:aging_regulated
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage.	DESeq	WBPaper00053302:stavudine_24h_regulated
	Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy.	Cufflinks	WBPaper00065120:body-muscle-transcriptome
Temprature shift to 28C for 24 hours.	Transcripts that showed significantly decreased expression after animals were exposed to 28C temperature for 24 hours.	Differentially expressed genes wereidentified using DESeq (v.1.18.0) by normalizing readsbased on the negative binomial distribution method andcomparing each HS timepoint to the 0-h control.	WBPaper00061341:28C_24h_downregulated
Temprature shift to 28C for 48 hours.	Transcripts that showed significantly decreased expression after animals were exposed to 28C temperature for 48 hours.	Differentially expressed genes wereidentified using DESeq (v.1.18.0) by normalizing readsbased on the negative binomial distribution method andcomparing each HS timepoint to the 0-h control.	WBPaper00061341:28C_48h_downregulated
	Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals.	DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2.	WBPaper00062159:hda-2(ok1479)_upregulated
	Transcripts that showed altered expression in cat-1(RNAi) animals comparing to control animals injected with empty vector.	p-value <= 0.05	WBPaper00066902:cat-1(RNAi)_regulated

13 Expression Patterns

• Primary Identifier: Expr4393
• Pattern: The GFP signal was first detected from the 3-fold stage of embryogenesis during development. At the 3-fold stage, GFP expression was observed in hypodermal and intestinal tissues. During larval and adult stages, GFP was strongly detected in the hypodermis and intestine as well as the excretory cells.

• Primary Identifier: Expr4394
• Pattern: Antibody staining was detected in the H-shape excretory cells and the intestine.

• Primary Identifier: Expr5295
• Remark: Also expressed in (comments from author) : Mosaic population. Strain: BC10160
• Reporter Gene: [vha-8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GAAATCCGCCTGAAAAATCA] 3' and primer B 5' [GATTCCGATGGCTACAGTCG] 3'.
• Pattern: Adult Expression: Reproductive System; vulval muscle; hypodermis; excretory cell; unidentified cells in head; Larval Expression: hypodermis; excretory cell

• Primary Identifier: Expr49
• Remark: Fusion junction ...CCGTGAGAAGGATCTTCGTCTTGTTGAGCAACTTTTGCCAGAGTGCCTTGACGGACTTCAAAAGGAGTG GGGAAGCACCACCAAGGTCGTTCTCGATAAACCAAAAACTTCTTGCCATCGGAGTCTGCTGGAGGAGTTGAA CTTTCTGCTCGTGCTGGAAAGATC/lacZ. Legacy Data: Author "Arnold JM" "Herbert R" "Hope IA" Date 1992-01. Young and Hope (1993). Dev. Dynam. 196:124-132 = [cgc1752]
• Pattern: b-galactosidase expression in the excretory cell and lateral nuclei of the hypodermis adjacent to the anterior and posterior branches of the excretory cell. The b-galactosidase appears to be localized to the channels which run within the lateral canals and the sinus in the cell body with which the channels connect. Initially approximately 20 hypodermal nuclei stained, possibly corresponding to the nuclei of the seam cells which constitute the two bands of the lateral hypodermis in the first larval stage. During development the seam cells give rise to two sets of 65 hypodermal nuclei present in the adult, which could correspond to the total number of staining nuclei in the adult.

• Primary Identifier: Expr2036130
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1032934
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr2627
• Pattern: Antibody staining patterns were consistent with the vha-8::GFP reporter gene expression pattern through all developmental stages, beginning at comma stage embryo to adult. Furthermore, vha-8 expression in canals of the H-shaped excretory cell, was prominently observed in a magnified image. Presumably, VHA-8 is expressed in syncytial hypodermal cells as well as in the excretory cell.
• Subcellular Localization: Subcellular localization of vha-8 by immuno-gold electron microscopy using anti-VHA-8 antibodies detected signals in the cytoplasm of the excretory canals and stacked sheets of the plasma membranes of the syncytial hypodermal cells.

• Primary Identifier: Expr2626
• Pattern: Transgenic worms at all developmental stages showed strong expression of vha-8::GFP reporter gene in the H-shaped excretory cell.

• Primary Identifier: Expr1028742
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr2017994
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1144910
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr2625
• Pattern: The 1.3-kb vha-8 transcript, corresponding to the predicted size of vha-8 cDNA, was expressed at all developmental stages. On the other hand, the 1.0-kb transcript appeared to be expressed slightly higher in L2 larval stage.

• Primary Identifier: Chronogram2072
• Remark: Original chronogram file: chronogram.988.xml
• Reporter Gene: [C17H12.14:gfp] transcriptional fusion.

12 GO Annotation

9 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00006917
• Start: 6791074
• End: 6792455
• Strand: 1

12 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 1382

1 Sequence Ontology Term

• Name: gene

6 Strains

• WBStrain00023532
• WBStrain00029316
• WBStrain00029318
• WBStrain00035242
• WBStrain00051766
• WBStrain00051767

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrIV_6790489..6791073
• Length (nt): 585
• Chromosome Location: IV: 6790489-6791073
• Organism: Caenorhabditis elegans