WormMine: Gene WBGene00006921

• WormBase Gene ID: WBGene00006921
• Gene Name: vha-12
• Sequence Name: F20B6.2
• Brief Description: vha-12 encodes an ortholog of subunit B of the cytoplasmic (V1) domainof vacuolar proton-translocating ATPase (V-ATPase); VHA-12 isorthologous to human ATP6V1B1 (OMIM:192132, mutated in distal renaltubular acidosis with progressive sensorineural deafness) and ATP6V1B2(OMIM:606939); VHA-12 and TAG-300/Y110A7A.12 are co-orthologs; VHA-17,like VHA-1 and VHA-12, antagonizes EFF-1-mediated cell fusion inhypodermal cells; VHA-12 is required for necrosis, since mutation ofvha-12 suppresses necrotic neurodegeneration, cytoplasmic acidification,and thapsigargin-induced cell death; VHA-12 is predicted to bind ATP aspart of a cytosolic VHA-12/VHA-13 heterohexamer, whose ATP hydrolysisdrives the V-ATPase rotor; general levels of VHA-12 protein are very lowin embryos but increase strongly after hatching.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable proton-transporting ATPase activity, rotational mechanism. Involved in several processes, including positive regulation of apoptotic process involved in development; positive regulation of neurotransmitter secretion; and regulation of intracellular pH. Predicted to be part of proton-transporting V-type ATPase, V1 domain. Expressed in excretory pore; hypodermal cell; muscle cell; neurons; and somatic cell. Human ortholog(s) of this gene implicated in autosomal dominant congenital deafness with onychodystrophy and renal tubular acidosis. Is an ortholog of human ATP6V1B2 (ATPase H+ transporting V1 subunit B2).
• Biotype: SO:0001217
• Genetic Position: X :-8.04252 ±0.023236
• Length (nt): 2051

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00006921

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:F20B6.2.1	F20B6.2.1	1904	X: 4191094-4193144

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:F20B6.2	F20B6.2	1476	X: 4191096-4191332

32 RNAi Result

• WBRNAi00095573
• WBRNAi00096597
• WBRNAi00096600
• WBRNAi00096723
• WBRNAi00096725
• WBRNAi00096727
• WBRNAi00096770
• WBRNAi00096772
• WBRNAi00096774
• WBRNAi00096776
• WBRNAi00096775
• WBRNAi00096800
• WBRNAi00085320
• WBRNAi00031157
• WBRNAi00008665
• WBRNAi00061158
• WBRNAi00045077
• WBRNAi00065013
• WBRNAi00090879
• WBRNAi00091163
• WBRNAi00091162
• WBRNAi00093240
• WBRNAi00025148
• WBRNAi00099047
• WBRNAi00099115
• WBRNAi00095908
• WBRNAi00095985
• WBRNAi00096060
• WBRNAi00096137
• WBRNAi00096214

31 Allele

• gk963725
• gk964260
• WBVar01601487
• WBVar01601488
• gk277576
• gk277575
• gk277574
• gk277573
• gk277572
• gk277571
• ok821
• WBVar01814770
• WBVar01814773
• WBVar01814772
• WBVar01814771
• gk401455
• gk418047
• gk387672
• gk793276
• gk842623
• gk864660
• gk629998
• gk313376
• gk505689
• gk559419
• gk517063
• gk846896
• gk879986
• gk672728
• gk436939

1 Chromosome

• WormBase ID: X
• Organism: Caenorhabditis elegans
• Length (nt): 17718942

1 Chromosome Location

• Feature . Primary Identifier: WBGene00006921
• Start: 4191094
• End: 4193144
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrX_4193145..4194013
• Length (nt): 869
• Chromosome Location: X: 4193145-4194013
• Organism: Caenorhabditis elegans

244 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	oocyte proteins identified by two or more unique peptides during proteomics study.	In the pooled data set, 1453 C. elegans proteins were identified with a probability >= 0.9 according to ProteinProphet, of which 1165 proteins were identified by more than one unique peptide.	WBPaper00038289:oocyte_protein
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
	TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood.	SAM	WBPaper00031040:TGF-beta_adult_upregulated
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts that showed significantly decreased expression at 11-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites.	DESeq2, fold change > 2, FDR < 0.05	WBPaper00065835:Day11_vs_Day1_downregulated
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts that showed significantly decreased expression in atfs-1(cmh15) (null allele) animals comparing to in N2 animals at L4 larva stage.	edgeR, fold change > 2, FDR < 0.05	WBPaper00060909:atfs-1(cmh15)_downregulated
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Genes with expression level regulated by genotype (N2 vs CB4856) and age at L3 larva and Late reproduction stage (96 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_age_regulated_developing
	Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-1-adult_vs_L4_upregulated_daf-16(mu86);glp-1(e2141)
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
Bacteria infection: Bacillus thuringiensis	Transcripts that showed significantly increased expression in N2 animals infected by bacteria BMB171/Cry5Ba, an acrystalliferous Bt mutant BMB171 transformed with toxin gene cry5Ba on the shuttle vector pHT304, comparing to N2 animals infected by BMB171/pHT304.	N.A.	WBPaper00064229:B.thuringiensis-Cry5Ba_upregulated
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_6h
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M
	Transcripts that showed significantly increased expression in mrg-1(qa6200) comparing to in control animals in primordial germ cells (PGCs) at L1 larva stage.	DESeq2(v1.32.0), FDR < 0.05.	WBPaper00064315:mrg-1(qa6200)_upregulated_PGCs
	Transcripts that showed significantly increased expression in hrde-1(tm1200) animals, comparing to in N2, after growing at 25C for five generations (late generation).	CuffDiff2	WBPaper00051265:F4_hrde-1(tm1200)_upregulated
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
	Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage.	DESeq2 version 1.22.2, p < 0.05	WBPaper00064716:paraquat_downregulated

9 Expression Patterns

• Primary Identifier: Expr5799
• Remark: Strain: BC14129
• Reporter Gene: [vha-12::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATACCAAAATGGAAAACTGGAAAA] 3' and primer B 5' [GGCAGCGATTCCTGAAAA] 3'.
• Pattern: Adult Expression: pharynx; excretory cell; Larval Expression: pharynx; intestine; excretory cell

• Primary Identifier: Expr9995
• Pattern: vha-12 is broadly expressed in most, if not all, somatic cell-types in larvae and adults. Robust GFP expression is observed in the H-shaped excretory cell, the excretory pore, intestine, and hypodermal cells. GFP reporter expression is observed at low levels in muscle. Consistent with the uncoordinated phenotype, expression is observed in all neurons.

• Primary Identifier: Expr2036114
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1032938
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Chronogram944
• Remark: Original chronogram file: chronogram.1991.xml
• Reporter Gene: [F20B6.2:gfp] transcriptional fusion.

• Primary Identifier: Expr2017978
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr13439
• Subcellular Localization: VHA-3, VHA-12, LMTR-3 and LMTR-12 all localized on the lysosomes of C. elegans, as they have similar staining pattern with lysosomal marker LMP-1.

• Primary Identifier: Expr1018114
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr1149027
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

24 GO Annotation

10 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00006921
• Start: 4191094
• End: 4193144
• Strand: 1

24 Ontology Annotations

2 Regulates Expr Cluster

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly decreased expression in vha-12(ok281) comparing to in N2 at L4 larva stage.	Fold change > 2, FDR < 0.01	WBPaper00066743:vha-12(ok281)_downregulated
	Transcripts that showed significantly increased expression in vha-12(ok281) comparing to in N2 at L4 larva stage.	Fold change > 2, FDR < 0.01	WBPaper00066743:vha-12(ok281)_upregulated

1 Sequence

• Length: 2051

1 Sequence Ontology Term

• Name: gene

2 Strains

• WBStrain00031649
• WBStrain00051767

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrX_4186757..4191093
• Length (nt): 4337
• Chromosome Location: X: 4186757-4191093
• Organism: Caenorhabditis elegans