WormMine: Gene WBGene00007388

• WormBase Gene ID: WBGene00007388
• Gene Name: folt-1
• Sequence Name: C06H2.4
• Brief Description: folt-1 encodes a folate transporter required for folate uptake; FOLT-1 is orthologous to the human folate transporter, SLC19A3 (Solute Carrier Family 19 (thiamine transporter), Member 3); folt-1 is required for proper germline function, oogenesis and sperm number in males, and for normal life-span; folt-1 mutants and folt-1(RNAi) animals show significantly lowered folate uptake; heterologously expressed FOLT-1 transports folate in vitro; FOLT-1 activity is acid-dependent, is sodium-independent, and is inhibited by folate derivatives, sulfasalazine, or anion transport inhibitors such as 4,4''-diisothio-cyanatostilbene-2,2''-disulphonic acid (DIDS); folt-1 is expressed in several tissues, including (most strongly) pharynx and posterior intestine, as well as head, body wall, vulva muscles, and gonad sheath cells.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable folic acid binding activity and vitamin transmembrane transporter activity. Predicted to be involved in transmembrane transport. Predicted to be located in plasma membrane. Expressed in head; head muscle; and tail. Used to study folic acid deficiency anemia. Human ortholog(s) of this gene implicated in several diseases, including abdominal aortic aneurysm; biotin-responsive basal ganglia disease; and cleft lip. Is an ortholog of human SLC19A3 (solute carrier family 19 member 3).
• Biotype: SO:0001217
• Genetic Position: V :2.95795 ±0.000704
• Length (nt): 1643

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00007388

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:C06H2.4.1	C06H2.4.1	1439	V: 11141479-11143121

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:C06H2.4	C06H2.4	1362	V: 11141498-11141810

3 RNAi Result

• WBRNAi00039953
• WBRNAi00028606
• WBRNAi00065901

22 Allele

• gk963271
• gk963301
• gk964451
• gk964452
• gk511303
• gk678697
• gk636463
• gk642895
• gk359894
• gk452455
• gk687706
• gk575804
• gk324180
• gk502952
• gk809279
• gk695551
• WBVar01865525
• ok1460
• WBVar01689659
• gk246871
• gk246872
• gk959651

1 Chromosome

• WormBase ID: V
• Organism: Caenorhabditis elegans
• Length (nt): 20924180

1 Chromosome Location

• Feature . Primary Identifier: WBGene00007388
• Start: 11141479
• End: 11143121
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

0 Downstream Intergenic Region

141 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals.	Fold change > 2, FDR < 0.01.	WBPaper00065993:glp-1(e2141)_upregulated
	Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin-Allantoin_upregulated
	Transcripts that showed significantly increased expression after animals were treated with 100uM Psora and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Psora-Allantoin_upregulated
	Transcripts that showed significantly increased expression after animals were treated with 100uM Rapamycin and 50mM Metformin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Metformin_upregulated
	Genes that showed significantly increased expression in wrn-1(gk99) comparing to in N2, according to RNAseq.	DESeq was used to calculate the fold changes, log fold changes, and significance of the changes for each comparison.	WBPaper00045934:wrn-1(gk99)_upregulated
	Genes that are significantly up regulated in tdp-1(ok803) poly(A) RNA-seq verses in N2.	DESeq v1.14, with cut-off p-value < 0.05 and FDR < 0.1.	WBPaper00046012:tdp-1(ok803)_upregulated
	Transcripts that showed significantly decreased expression in atfs-1(cmh15) (null allele) animals comparing to in N2 animals at L4 larva stage.	edgeR, fold change > 2, FDR < 0.05	WBPaper00060909:atfs-1(cmh15)_downregulated
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva fem-3(q20) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-1-adult_vs_L4_upregulated_fem-3(q20)
	Transcripts that showed significantly increased expression in mrg-1(qa6200) comparing to in control animals in primordial germ cells (PGCs) at L1 larva stage.	DESeq2(v1.32.0), FDR < 0.05.	WBPaper00064315:mrg-1(qa6200)_upregulated_PGCs
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
	Significantly upregulated genes from clk-1(qm30) microarrays using SAM algorithm with an FDR < 0.1 from adult-only chips.	SAM algorithm with an FDR < 0.1.	WBPaper00033065:clk-1(qm30)_upregulated
Temprature shift to 28C for 24 hours.	Transcripts that showed significantly decreased expression after animals were exposed to 28C temperature for 24 hours.	Differentially expressed genes wereidentified using DESeq (v.1.18.0) by normalizing readsbased on the negative binomial distribution method andcomparing each HS timepoint to the 0-h control.	WBPaper00061341:28C_24h_downregulated
Temprature shift to 28C for 48 hours.	Transcripts that showed significantly decreased expression after animals were exposed to 28C temperature for 48 hours.	Differentially expressed genes wereidentified using DESeq (v.1.18.0) by normalizing readsbased on the negative binomial distribution method andcomparing each HS timepoint to the 0-h control.	WBPaper00061341:28C_48h_downregulated
	Transcripts that showed significantly increased expression in clk-1(qm30) comparing to in N2.	Differential gene expression analysis was performed using the quasi-likeli-hood framework in edgeR package v. 3.20.1 in R v. 3.4.1.	WBPaper00053810:clk-1(qm30)_upregulated
	Transcripts that showed significantly increased expression in isp-1(qm150) comparing to in N2.	Differential gene expression analysis was performed using the quasi-likeli-hood framework in edgeR package v. 3.20.1 in R v. 3.4.1.	WBPaper00053810:isp-1(qm150)_upregulated
	Transcripts that showed significantly increased expression in nuo-6(qm200) comparing to in N2.	Differential gene expression analysis was performed using the quasi-likeli-hood framework in edgeR package v. 3.20.1 in R v. 3.4.1.	WBPaper00053810:nuo-6(qm200)_upregulated
	Genes down-regulated following nhr-25(RNAi).	Pair-wise significance testing (mutant/RNAi vs. wild-type/vector) was performed using the Bioconductor package limma and p-values were initially corrected for multiple testing using the false discovery rate (FDR) method of Benjamini and Hochberg. Authors defined differential expression as log2(ratio) >= 0.848 with the FDR set to 5%, and p-value <= 0.001.	WBPaper00045015:nhr-25(RNAi)_downregulated
	Transcripts that showed significantly increased expression in mep-1(ne4629[MEP-1-GFP-Degron]) in gonads dissected from 1-day old adult animals.	Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R.	WBPaper00061479:mep-1(ne4629)_upregulated
	Transcripts that showed significantly increased expression in ubc-9(ne4833[ubc-9(G56R)] in gonads dissected from 1-day old adult animals.	Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R.	WBPaper00061479:ubc-9(ne4833)_upregulated
	Transcripts that showed significantly increased expression in BAT525 [hmg-3 (tm2539) / dpy-5(e61) unc-13(e1091) I.] comparing to in N2 at 1-day post L4 adult hermaphrodite stage.	DESeq 2, fold change > 4, adjusted p-value < 0.05.	WBPaper00055013:hmg-3(bar24)_upregulated
	Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals.	DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2.	WBPaper00062159:hda-2(ok1479)_upregulated
Bacteria infection: Pseudomonas aeruginosa PA14. 4 hours at 25C.	Transcripts that showed significantly decreased expression after N2 L4 animals were infected by P. aeruginosa (PA14) bacteria for 24 hours at 25C.	DESeq R package (1.18.0), FDR < 0.05 and fold change > 2.	WBPaper00062184:PA14_downregulated
	Transcripts that showed significantly decreased expression in adbp-1(qj1) comparing to in N2 animals at L4 larva stage.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00067079:adbp-1(qj1)_downregulated_L4
	Transcripts that showed significantly decreased expression in set-2(tm1630) animals at embryo stage, comparing to in N2 animals.	DESeq2 (v2.1.8.3) was used to determine DE genes and to generate principal component and scatter plots. DE genes with FDR < 0.05 were analysed using g:Profiler with Bonferroni correction.	WBPaper00060014:set-2(tm1630)_downregulated
	Transcripts detected in germline isolated from day-1 adult hermaphrodite animals.	All three experiments have CPM >= 1.	WBPaper00067147:germline_expressed
	Transcripts that showed altered expression from P0 to F2 generation animals after N2 parental generation were treated with antimycin, but not in damt-1(gk961032) P0 to F2 animals after the parenal generaton were treated with antimycin.	N.A.	WBPaper00055862:antimycin_damt-1(gk961032)_regulated
	Transcripts that showed significantly increased expression in nuo-6(qm200) comparing to in N2.	EdgeR v. 3.20.2, fold change > 2.	WBPaper00055941:nuo-6(qm200)_upregulated

8 Expression Patterns

• Primary Identifier: Expr4731
• Remark: folt-1 = C06H2.4
• Pattern: Expression was consistently higher in the pharynx and the posterior part of intestine; it was also observed in the body wall muscles, head muscles and vulva muscles of these transgenic animals.

• Primary Identifier: Expr5195
• Remark: Strain: BC14465
• Reporter Gene: [C06H2.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTGCAAAGAAAAGGATAGTTCCA] 3' and primer B 5' [CGCCAGCTGATCTGGATT] 3'.
• Pattern: Adult Expression: pharynx; intestine; Reproductive System; vulval muscle; gonad sheath cells; body wall muscle; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; intestine; body wall muscle; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr1033181
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr2011869
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1026163
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr1144028
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Chronogram1873
• Remark: Original chronogram file: chronogram.790.xml
• Reporter Gene: [C06H2.4:gfp] transcriptional fusion.

• Primary Identifier: Expr2030107
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

10 GO Annotation

13 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00007388
• Start: 11141479
• End: 11143121
• Strand: 1

10 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 1643

1 Sequence Ontology Term

• Name: gene

2 Strains

• WBStrain00036202
• WBStrain00003049

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrV_11140815..11141478
• Length (nt): 664
• Chromosome Location: V: 11140815-11141478
• Organism: Caenorhabditis elegans