WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00007627 Gene Name  ccdc-55
Sequence Name  ? C16C10.6 Brief Description  ccdc-55 encodes a conserved coiled-coil domain-containing protein that is related to the mammalian nuclear speckle splicing regulatory proteins 1 (NSrp1s); in C. elegans, CCDC-55 activity is required for early larval development and also for distal tip cell (DTC) migration; cell type-specific RNAi experiments suggest that CCDC-55 functions within the DTC to regulates its migration; genetic interactions suggest that CCDC-55 functions at least partially in parallel with the E3 ubiquitin ligases RNF-5 and RNF-121 to regulate DTC migration; when expressed in the DTC, CCDC-55 localizes to the cytoplasm and the nucleus.
Organism  Caenorhabditis elegans Automated Description  Predicted to enable mRNA binding activity. Involved in inductive cell migration and nematode larval development. Located in cytoplasm and nucleus. Expressed in gonad; hypodermis; muscle cell; and vulva. Is an ortholog of human NSRP1 (nuclear speckle splicing regulatory protein 1).
Biotype  SO:0001217 Genetic Position  III :-3.72766 ±0.003169
Length (nt)  ? 1822
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00007627

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:C16C10.6.1 C16C10.6.1 1286   III: 4166944-4168765
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:C16C10.6 C16C10.6 1179   III: 4167051-4167968

30 RNAi Result

WormBase ID
WBRNAi00067068
WBRNAi00067205
WBRNAi00067228
WBRNAi00067370
WBRNAi00067458
WBRNAi00067821
WBRNAi00040683
WBRNAi00091842
WBRNAi00094156
WBRNAi00071662
WBRNAi00094278
WBRNAi00033431
WBRNAi00071261
WBRNAi00024577
WBRNAi00000153
WBRNAi00001693
WBRNAi00002527
WBRNAi00008410
WBRNAi00091844
WBRNAi00091846
WBRNAi00091848
WBRNAi00091847
WBRNAi00091850
WBRNAi00091849
WBRNAi00091852
WBRNAi00091851
WBRNAi00065696
WBRNAi00091843
WBRNAi00091840
WBRNAi00111713

16 Allele

Public Name
h3082
ok2851
WBVar01785400
gk172272
WBVar02041307
gk172273
gk454319
gk770953
tm7565
gk865973
gk498529
gk683095
gk471221
WBVar01644022
gk698076
gk669536

1 Chromosome

WormBase ID Organism Length (nt)
III Caenorhabditis elegans 13783801  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00007627 4166944 4168765 -1

4 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  
Panther orthologue and paralogue predictions  

1 Downstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrIII_4166846..4166943   98 III: 4166846-4166943 Caenorhabditis elegans

97 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. DESeq. False discovry rate (FDR) < 0.1. WBPaper00048988:neuron_expressed
  Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:hypodermis_expressed
  Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:intestine_expressed
  Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:NMDA-neuron_expressed
  Maternal class (M): genes that are called present in at least one of the three PC6 replicates. A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing. [cgc5767]:expression_class_M
  Transcripts that showed significantly increased expression in 10-days post L4 adult hermaphrodite N2 grown at 20C, comparing to in 1-day post L4 adult hermaphrodite N2 animals grown at 20C. CuffDiff, fold change > 2. WBPaper00065096:Day10_vs_Day1_upregulated
  Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy. Cufflinks WBPaper00065120:body-muscle-transcriptome
  Transcripts that showed significantly increased expression in xrep-4(lax137). DESeq2. Genes were selected if their p value < 0.01. WBPaper00066062:xrep-4(lax137)_upregulated
  Genes with increased RNA expression after 24 hours rotenone treatment EdgeR provides statistical routines for determining differential expression in digital gene expression data using a model based on the negative binomial distribution. The resulting p-values were adjusted using the Benjamini and Hochbergs approach for controlling the false discovery rate (FDR). Transcripts with an adjusted p-value smaller 0.05 were assigned as differentially expressed. WBPaper00044426:rotenone_24h_upregulated
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:A-class-motor-neurons_L2-larva_expressed
  Transcripts that showed significantly decreased expression in tetraploid N2 comparing to diploid N2 animals at L4 larva stage. DESeq2 R package (1.20.0), fold change > 2, and FDR < 0.05. WBPaper00066110:tetraploid_vs_diploid_downregulated
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:all-neurons_L2-larva_expressed
  Transcripts that showed significantly increased expression in animals exposed to Leptomycin B for 20 hours at 25C. p < 0.01, logFC > 1 or p < 0.01, logFC < -1. WBPaper00066610:Leptomycin-B_upregulated_25C_20h
  Transcripts detected in germline isolated from day-1 adult hermaphrodite animals. All three experiments have CPM >= 1. WBPaper00067147:germline_expressed
  Genes that were not enriched in either spermatogenic fem-3(q96gf) nor oogenic fog-2(q71) gonads, according to RNAseq analysis. To identify differentially expressed transcripts, authors used R/Bioconductor package DESeq. WBPaper00045521:Gender_Neutral
  Transcripts that showed decreased expression in hlh-11(ko1) knockout strain comparing to in wild type background. DESeq2, FDR < 0.05 WBPaper00060683:hlh-11(ko1)_downregulated
Starvation 48 hours at L1 arrest Transcripts that showed significantly increased expression in starved N2 animals (48 hours at L1 arrest) Fold change > 2. WBPaper00064005:starvation_upregulated_N2_mRNA
Bacteria infection: Enterococcus faecalis OG1RF. Exposure for 16 hours. Transcripts that showed significantly decreased expression in hpx-2(dg047) after animals were exposed to E. faecalis OG1RF for 16 hours comparing to exposure to E. Coli OP50. Cuffcompare and Cuffdiff WBPaper00056090:E.faecalis_downregulated_hpx-2(dg047)
  Genes found to be regulated by low-copy overexpression of sir-2.1 with p < 0.014. N.A. WBPaper00026929:sir-2.1_overexpression_regulated
  TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood. SAM WBPaper00031040:TGF-beta_adult_downregulated
  Transcripts that showed significantly increased expression in set-2(tm1630) animals at embryo stage, comparing to in N2 animals. DESeq2 (v2.1.8.3) was used to determine DE genes and to generate principal component and scatter plots. DE genes with FDR < 0.05 were analysed using g:Profiler with Bonferroni correction. WBPaper00060014:set-2(tm1630)_upregulated
  Genes expressed in N2. Expressed transcripts were identified on the basis of a Present call in 3 out of 4 N2 experiments as determined by Affymetrix MAS 5.0. WBPaper00025141:N2_Expressed_Genes
  Embryonic class (E): genes that significantly increase in abundance at some point during embryogenesis. A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing. [cgc5767]:expression_class_E
  Transcripts that showed significantly increased expression in zip-3(gk3164) comparing to in N2, after exposed to P. aeruginosa for 18 hours. p < 0.05 WBPaper00056326:zip-3(gk3164)_upregulated_P.aeruginosa-infected
  Transcripts that showed differential expression between 24 and 26 hours post hatching L2d and dauer committed larvae of daf-9(dh, triggered by the dafachronic acid (DA) growth hormone6). Cluster 2 genes' expression gradually increased into dauer. Benjamini Hochberg corrected q-value < 0.01. WBPaper00053388:dauer_regulated_Cluster2
  Transcripts that showed significantly decreased expression in pals-22(jy3) comparing to in N2 at L4 larva stage. Differential expression analysis was performed in RStudio (v1.1.453) using R (v3.50) and Bioconductor (v3.7) packages. As outlined in the RNAseq123 vignette, data was imported, filtered and normalized using edgeR, and linear modeling and differential expression analysis was performed using limma. An FDR cutoff of <0.01 was used to define differentially expressed genes; no fold-change criteria was used. WBPaper00056034:pals-22(jy3)_downregulated
  Transcripts enriched in germline by comparing dissected germline tissue with dissected intestine tissue, both injected with empty RNAi vector. Genes were determined germline-enriched if the lowest expression value (log2(FPKM+1)) observed in the germline empty vector samples was at least 2-fold higher than the highest expression value observed in the intestine empty vector samples. WBPaper00051039:germline_enriched
Treatment with 2.0mM of HuminFeed until young adult stage (3 days). Gene significantly up-regulated by treatment with 2.0mM of HuminFeed until young adult stage (3 days), with a minimum fold change in gene expression of 1.25. For selection of DEGs, an unpaired t -test was performed followed by a significance analysis of microarray (SAM) test including a calculation that estimates the false discovery rate (FDR). FDR, reducing on the one hand type I errors for null associations, was set to a non-stringent level of <12.5%, mainly to guard from an increase of type II error and also based on findings by Levine et al. (2011), which described 12.5% as most acceptable optimum level of FDR, representing the 90th percentile of the normal distribution curve. DEGs exceeding a fold change of 1.25 were further analyzed with respect to their functional clustering. This fold-cut-off was chosen to allow an interpretation that is biologically meaningful, akin to the notion that data of sound technical and experimental quality which returns strong, statistically significant, absolute signal intensities is sufficiently robust to justify a fold-cut-off of >1.2. This analysis was conducted using the functional annotation clustering tool of the Database for Annotation, Visualization, and Integrated Discovery (DAVID; Huang et al., 2007). WBPaper00041002:HF_3d_2.0mM_Up
Bacteria infection: Xenorhabdus nematophila Caenorhabditis elegans Genes with expression levels changed significantly after treatment of Xenorhabdus nematophila. Differential expression were calculated by empirical eBayes method using eBayes function. P_value <= 0.01 and log2 fold change > 1 were used to call differentially expressed genes in all datasets. WBPaper00041606:CE_X.nematophila_regulated
control(maintained under normal lab light (mostly dark, in incubators).) vs UVC-EtBr-exposed(exposed to 7.5 J/m2 UVC radiation 3 times, 24 h apart (48 h total) and exposed to EtBr (5ug/mL in agar).) at 3 h after the third UVC dose (51h), which is also 3 h after being placed on food. Genes differentially expressed in control vs after UVC exposure and EtBr treatment at the 3h timepoint (3 h after the third UVC dose (51h), which is also 3 h after being placed on food). Transcripts were defined as fold-change >1.2, p < 0.05 based on Rosetta Resolver analysis for all pairwise treatment comparisons. The fold-change refers to the second intensity over the first. WBPaper00041939:control_vs_UVC-EtBr-exposed_51h

8 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Strain: BC10891 [C16C10.6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CAGCAGATTTTTGGAATTTTCAC] 3' and primer B 5' [GCCGTTTTGATGCGATCT] 3'. Expr5280 Adult Expression: intestine; Nervous System; head neurons; Larval Expression: intestine; Nervous System; head neurons;  
    Expr2009757 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr9952 CCDC- 55::GFP is broadly expressed in larvae and adults. The ccdc-55 message is transcribed as part of a multi-gene operon, CEOP3156, with the predicted promoter 5' of rnf-121. It is likely the expression pattern seen in the rnf-121::GFP animals is relevant for ccdc-55, this includes muscle, seam, hypodermis, vulva and somatic gonad with prominent expression in the DTC. In C. elegans, genes contained in operons can also be expressed independently (Blumenthal and Gleason, 2003), so the rnf- 121-based expression pattern may not completely recapitulate the endogenous expression of ccdc-55. Animals expressing a CCDC-55::GFP fusion protein in the DTC under the control of the lag-2 promoter were generated. In these animals, it was observed a nuclear and cytoplasmic distribution of CCDC-55::GFP in the DTC. However, the CCDC-55 localization was predominantly nuclear.
    Expr1033293 Tiling arrays expression graphs  
    Expr1021763 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
Original chronogram file: chronogram.1541.xml [C16C10.6:gfp] transcriptional fusion. Chronogram524    
    Expr2027997 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr1144728 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  

12 GO Annotation

Annotation Extension Qualifier
  located_in
part_of(WBbt:0006865) located_in
  located_in
  located_in
occurs_in(WBbt:0006865) involved_in
  involved_in
  involved_in
  involved_in
  involved_in
  enables
part_of(WBbt:0006865) located_in
  located_in

5 Homologues

Type
least diverged orthologue
least diverged orthologue
least diverged orthologue
least diverged orthologue
least diverged orthologue

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00007627 4166944 4168765 -1

12 Ontology Annotations

Annotation Extension Qualifier
  located_in
part_of(WBbt:0006865) located_in
  located_in
  located_in
occurs_in(WBbt:0006865) involved_in
  involved_in
  involved_in
  involved_in
  involved_in
  enables
part_of(WBbt:0006865) located_in
  located_in

0 Regulates Expr Cluster

1 Sequence

Length
1822

1 Sequence Ontology Term

Identifier Name Description
gene  

2 Strains

WormBase ID
WBStrain00037361
WBStrain00001555

1 Upstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrIII_4168766..4168776   11 III: 4168766-4168776 Caenorhabditis elegans