WormMine: Gene WBGene00008656

• WormBase Gene ID: WBGene00008656
• Gene Name: lron-5
• Sequence Name: F10F2.4
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to be involved in cell development. Predicted to be located in membrane. Expressed in nerve ring; tail; and ventral nerve cord. Human ortholog(s) of this gene implicated in several diseases, including artery disease (multiple); corneal disease (multiple); and periodontal disease (multiple). Is an ortholog of several human genes including FMOD (fibromodulin); LUM (lumican); and OMD (osteomodulin).
• Biotype: SO:0001217
• Genetic Position: III :-2.9722±
• Length (nt): 3140

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00008656

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:F10F2.4.1	F10F2.4.1	2077	III: 4623029-4626168

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:F10F2.4	F10F2.4	1971	III: 4623052-4623345

7 RNAi Result

• WBRNAi00067524
• WBRNAi00001003
• WBRNAi00044289
• WBRNAi00044290
• WBRNAi00013073
• WBRNAi00005106
• WBRNAi00030783

38 Allele

• WBVar02122234
• gk963966
• h8507
• WBVar01330342
• WBVar01995043
• gk460911
• gk612377
• WBVar01445385
• gk576616
• gk852875
• gk173138
• gk894608
• gk173137
• gk614315
• gk439569
• gk676496
• WBVar01785528
• gk531503
• gk173140
• WBVar02078991
• gk173139
• gk173142
• gk173141
• gk5278
• gk959442
• gk934229
• gk557119
• gk414504
• gk805231
• gk673891

1 Chromosome

• WormBase ID: III
• Organism: Caenorhabditis elegans
• Length (nt): 13783801

1 Chromosome Location

• Feature . Primary Identifier: WBGene00008656
• Start: 4623029
• End: 4626168
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

0 Downstream Intergenic Region

161 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology.	DESEQ2, fold change > 2 and FDR < 0.01.	WBPaper00062103:neuron_enriched
	Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals.	Fold change > 2, FDR < 0.01.	WBPaper00065993:glp-1(e2141)_upregulated
	Transcripts that showed significantly increased expression in ogt-1(ok1474) neuronal cells isolated by FACs comparing to in FACs isolated neuronal cells from wild type.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00066485:ogt-1(ok1474)_upregulated_neuron
	Transcripts that showed significantly decreased expression in atfs-1(cmh15) (null allele) animals comparing to in N2 animals at L4 larva stage.	edgeR, fold change > 2, FDR < 0.05	WBPaper00060909:atfs-1(cmh15)_downregulated
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_daf-16(mu86);glp-1(e2141)
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
	Transcripts that showed significantly increased expression in hpk-1(pk1393) comparing to in N2 at adult day 2.	DESeq 2, fold change > 2, FDR < 0.05.	WBPaper00065581:hpk-1(pk1393)_upregulated
	Transcripts that showed significantly increased expression in hda-1(ne4752[3xFLAG-Degron-HDA-1]) in gonads dissected from 1-day old adult animals.	Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R.	WBPaper00061479:hda-1(ne4752)_upregulated
	Transcripts that showed significantly increased expression in wdr-23(mac32) embryos from parents fed with E. coliHB101, comparing to N2 embryos parents fed with E. coli HB101.	DESeq2, Fold Change > 2 or < 0.5.	WBPaper00059566:wdr-23(mac32)_upregulated
	Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals.	DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2.	WBPaper00062159:hda-2(ok1479)_upregulated
	Transcripts that showed significantly increased expression in srbc-48(ac23);kyIs262;fer-1(b232ts) comparing to in kyIs262;fer-1(b232ts), 24h after infection with P.aeruginosa.	DESeq2, FDR <0.05, fold change > 2.	WBPaper00059664:srbc-48(ac23)_upregulated
	Transcripts that showed significantly decreased expression after animals were treated with 100uM Psora and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Psora-Allantoin_downregulated
	Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin and 50mM Metformin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Metformin_downregulated
	Transcripts that showed significantly decreased expression after animals were treated with 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin-Allantoin_downregulated
	Transcripts that showed significantly decreased expression after animals were treated with 50uM Rifampicin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin_downregulated
	Transcripts that showed significantly decreased expression in set-2(tm1630) animals at embryo stage, comparing to in N2 animals.	DESeq2 (v2.1.8.3) was used to determine DE genes and to generate principal component and scatter plots. DE genes with FDR < 0.05 were analysed using g:Profiler with Bonferroni correction.	WBPaper00060014:set-2(tm1630)_downregulated
	Transcripts that showed altered expression from P0 to F2 generation animals after N2 parental generation were treated with antimycin, but not in damt-1(gk961032) P0 to F2 animals after the parenal generaton were treated with antimycin.	N.A.	WBPaper00055862:antimycin_damt-1(gk961032)_regulated
	Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(+), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage.	DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2.	WBPaper00050859:upregulated_P-granule(-)GFP(+)_vs_control_day2-adult
	Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(-), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage.	DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2.	WBPaper00050859:upregulated_P-granule(-)GFP(-)_vs_control_day2-adult
	Genes found to be regulated by low-copy overexpression of sir-2.1 with p < 0.014.	N.A.	WBPaper00026929:sir-2.1_overexpression_regulated
	Genes expressed in N2.	Expressed transcripts were identified on the basis of a Present call in 3 out of 4 N2 experiments as determined by Affymetrix MAS 5.0.	WBPaper00025141:N2_Expressed_Genes
	Transcripts that showed significantly decreased expression in nhr-114(gk849) comparing to wild type animals at L4 larva.	DESeq2 1.26.0, fold change > 2, FDR < 0.05.	WBPaper00064539:nhr-114(gk849)_downregulated
	Transcripts that showed significantly decreased expression in alg-1(gk214), comparing to in N2.	DESeq2, Fold change > 1.5.	WBPaper00051404:alg-1(gk214)_downregulated
24 hours of AgNPs exposure.	Genes downregulated more than 2 fold after 24 hours of AgNPs exposure.	Statistical differences between the control and exposed worms were determined by a parametric t test, and a Pearson correlation test was performed for correlation analysis, using the Statistical Package for the Social Sciences (SPSS, Chicago, IL).	WBPaper00034661:AgNPs_downregulated
	Transcripts that showed significantly increased expression in sma-4(rax3) comparing to in N2 at 1-day post-L4 adult hermaphrodite	HTseq-count was used to count reads mapped to each gene and counting data was imported to EdgeR for statistical analysis. Statistical significance was defined by adjusted P value (false discovery rate, FDR) of <0.05.	WBPaper00053184:sma-4(rax3)_upregulated

9 Expression Patterns

• Primary Identifier: Expr5725
• Remark: Strain: BC12414
• Reporter Gene: [F10F2.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGTAGGCGGATAAACTTCCCA] 3' and primer B 5' [GGTTGTCTCACTGACTGACTGC] 3'.
• Pattern: Adult Expression: intestine; Nervous System; head neurons; Larval Expression: intestine; Nervous System; head neurons

• Primary Identifier: Expr1033769
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr9906
• Pattern: Expressed in many neurons in head, VNC, and tail. GFP localization is primarily in the cell body and punctate. (golgi?)

• Primary Identifier: Chronogram928
• Remark: Original chronogram file: chronogram.1975.xml
• Reporter Gene: [F10F2.4:gfp] transcriptional fusion.

• Primary Identifier: Expr1023550
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr2013278
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr100
• Remark: Cells involved = RMFL/R or RMHL/R, i.e. neuronal G1 or G2 lineage Other strain-- UL282 late embryo(author) = 3-fold embryo(curator).
• Pattern: Expression is seen occasionally in 3-fold embryos and early larval stages but more consistently in late larvae and adults. Staining is seen in the cell bodies of neurons adjacent to the nerve ring. They are divided into two groups, with a pair of nuclei expressing dorsally in the lateral ganglion and another less distinct group of nuclei located across the isthmus in the ventral ganglion. This pattern is expressed at low levels which may account for the varying numbers of nuclei staining in the ventral ganglion. Expression in larvae is seen as 1 or 2 large nuclei which later may divide to become the aforementioned neuropil. Could these include the cells derived from G1 and/or G2 (RMFL/R or RMHL/R)

• Primary Identifier: Expr1148237
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr2031509
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

2 GO Annotation

7 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00008656
• Start: 4623029
• End: 4626168
• Strand: 1

2 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 3140

1 Sequence Ontology Term

• Name: gene

1 Strains

• WBStrain00047624

0 Upstream Intergenic Region