WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00008018 Gene Name  tbc-8
Sequence Name  ? C38H2.1 Organism  Caenorhabditis elegans
Automated Description  Enables small GTPase binding activity. Involved in dense core granule maturation. Located in Golgi cisterna; cytosol; and early endosome. Expressed in neurons. Is an ortholog of human SGSM2 (small G protein signaling modulator 2). Biotype  SO:0001217
Genetic Position  III :2.4777 ±0.002122 Length (nt)  ? 8279
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00008018

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:C38H2.1a.1 C38H2.1a.1 3032   III: 10364956-10373234
Transcript:C38H2.1b.1 C38H2.1b.1 2058   III: 10368766-10373054
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:C38H2.1a C38H2.1a 2742   III: 10365066-10365220
CDS:C38H2.1b C38H2.1b 2058   III: 10368766-10368882

5 RNAi Result

WormBase ID
WBRNAi00042175
WBRNAi00022304
WBRNAi00006272
WBRNAi00113379
WBRNAi00113380

149 Allele

Public Name
gk964518
gk963887
otn11146
otn11147
otn8618
otn9853
otn9854
otn9855
otn9856
otn9857
otn9858
otn9859
otn9860
otn12187
otn12186
otn12188
otn13137
WBVar02069716
WBVar02069717
WBVar01542243
WBVar01542244
WBVar01267689
WBVar01827933
otn17997
otn19719
gk664985
gk834431
gk407389
gk869704
gk477185

1 Chromosome

WormBase ID Organism Length (nt)
III Caenorhabditis elegans 13783801  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00008018 10364956 10373234 1

4 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  
Panther orthologue and paralogue predictions  

1 Downstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrIII_10373235..10380841   7607 III: 10373235-10380841 Caenorhabditis elegans

164 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells. DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction. WBPaper00060811:L1_vs_adult_upregulated_neural
  Transcripts of coding genes that showed significantly decreased expression in muscle. DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed. WBPaper00062325:muscle_depleted_coding-RNA
  Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. DESeq. False discovry rate (FDR) < 0.1. WBPaper00048988:neuron_expressed
  Genes significantly enriched (> 2x, FDR < 5%) in a particular cell-type versus a reference sample of all cells at the same stage. A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:A-class-motor-neurons_larva_enriched
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:all-neurons_L1-larva_expressed
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
Osmotic stress Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present DESeq(version 1.10.1), FDR < 0.05. WBPaper00050726:OsmoticStress_regulated_Food
  Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology. DESEQ2, fold change > 2 and FDR < 0.01. WBPaper00062103:neuron_enriched
Osmotic stress Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when no food was present DESeq(version 1.10.1), FDR < 0.05. WBPaper00050726:OsmoticStress_regulated_NoFood
  Genes that showed increased expression in wdr-5(ok1417) comparing with in N2. Statistical analysis for misexpression was performed using a moderated t test from the package limma. All genes with a false discovery rate (FDR) of <= 5% (p <= 0.05) were selected as differentially regulated. WBPaper00045861:wdr-5(ok1417)_upregulated
Bacteria infection: Enterococcus faecalis Genes with increased expression after 24 hours of infection by E.faecalis Fold changes shown are pathogen vs OP50. For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated. WBPaper00038438:E.faecalis_24hr_upregulated_TilingArray
  Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:arcade_intestinal-valve_expressed
  Genes significantly enriched in NSM neurons (isolated by FACS) versus the reference, according to RNAseq analysis towards total RNA. Gene expression quantification and differential expression was analyzed using cufflinks v2.2.1. Enriched contains only genes significantly enriched (differentially expressed >= 2.4 fold in total RNA or >= 3.2 fold in DSN treated total RNA) in the NSM neurons versus the reference. WBPaper00045974:NSM_enriched_totalRNA_RNAseq
  Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:body-muscle_expressed
  Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:GABAergic-neuron_expressed
  Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:NMDA-neuron_expressed
  Transcripts detected in germline isolated from day-1 adult hermaphrodite animals. All three experiments have CPM >= 1. WBPaper00067147:germline_expressed
  Transcripts that showed significantly increased expression after four-day-old young adult worms were placed on NGM plates seeded with OP50 in the presence 5% Agaro-oligosaccharides(AGO) for 24 h, comparing to animals grown in the absence of AGO. Fold change > 2. WBPaper00064306:Agaro-oligosaccharides_upregulated
  Transcripts that showed significantly increased expression in mrg-1(qa6200) comparing to in control animals in primordial germ cells (PGCs) at L1 larva stage. DESeq2(v1.32.0), FDR < 0.05. WBPaper00064315:mrg-1(qa6200)_upregulated_PGCs
Dietary restriction Transcripts that showed significantly decreased expression after N2 animals were under dietary restriction (DR, OP50 OD = 0.1) from 3-day post L4 till 6-day post L4 adult hermaphrodite stage, comparing to under ad libtum (AL, OP50 OD = 3) condition. Bioconductor package edgeR, p < 0.05. WBPaper00056443:DietaryRestriction_downregulated
  Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2. DEseq 1.18.0, adjusted p-value < 0.05. WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
  Transcripts that showed significantly increased expression in wdr-5(ok1417);skn-1(lax188) comparing to in skn-1(lax188) at day 2 adult stage. fold change > 2 WBPaper00058711:wdr-5(ok1417)_upregulated
  Transcripts that showed significantly increased expression in daf-2(e1370) comparing to in N2. Differential gene expression analysis was performed using the quasi-likeli-hood framework in edgeR package v. 3.20.1 in R v. 3.4.1. WBPaper00053810:daf-2(e1370)_upregulated
  Transcripts that showed significantly increased expression in hda-1(ne4752[3xFLAG-Degron-HDA-1]) in gonads dissected from 1-day old adult animals. Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R. WBPaper00061479:hda-1(ne4752)_upregulated
  Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:dopaminergic-neurons_L3-L4-larva_expressed
  Transcripts that showed significantly altered expression at URX, AQR, and PQR neurons in camt-1(ok515) animals comparing to in wild type AX1888-1 strain. RNA-seq data were mapped using PRAGUI - a Python 3-based pipeline for RNA-seq data analysis. WBPaper00061902:camt-1(ok515)_regulated_URX-AQR-PQR
  Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:PVD-OLL-neurons_L3-L4-larva_expressed
  Transcripts that showed significantly increased expression in wdr-23(mac32) embryos from parents fed with E. coliHB101, comparing to N2 embryos parents fed with E. coli HB101. DESeq2, Fold Change > 2 or < 0.5. WBPaper00059566:wdr-23(mac32)_upregulated
  Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals. DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2. WBPaper00062159:hda-2(ok1479)_upregulated
Starvation Transcripts that showed significantly altered expression by starvation with 100 mM salt (NaCl) DESeq(version 1.10.1), FDR < 0.05. WBPaper00050726:starvation_regulated_LowSalt

10 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
    Expr4306 Detected primarily in neurons.  
    Expr2035471 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
Strain: BC13836 [C38H2.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GAACTTTTCCATCTGTTTGTTCG] 3' and primer B 5' [GATATCTGCCGATGAATGCC] 3'. Expr5472 Adult Expression: Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; Larval Expression: Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons;  
    Expr10033 tbc-8 is exclusively expressed in neurons including the head and tail neurons as well as neurons in the ventral nerve cord (VNC). Fluorescently labeled TBC-8 showed a cytosolic localization with some punctate membrane staining. Partial localization of TBC-8 was observed with medial (mannosidase II) and trans-Golgi (APT-9) markers and an almost complete co-localization with the early endosomal marker RAB-5. However, we could not observe any localization of TBC-8 to RAB-7-positive late endosomes. This suggests that TBC-8 acts at the Golgi-endosomal interface.
    Expr1033487 Tiling arrays expression graphs  
    Expr1028934 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
    Expr1146170 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  
    Expr2017335 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr14938   Fluorescently labeled TBC-8 showed a cytosolic localization with some punctate membrane staining. Partial localization of TBC-8 was observed with medial (mannosidase II) and trans-Golgi (APT-9) markers and an almost complete co-localization with the early endosomal marker RAB-5. However, we could not observe any localization of TBC-8 to RAB-7-positive late endosomes. This suggests that TBC-8 acts at the Golgi-endosomal interface.
Original chronogram file: chronogram.474.xml [C38H2.1:gfp] transcriptional fusion. Chronogram1592    

19 GO Annotation

Annotation Extension Qualifier
  located_in
  enables
  enables
  located_in
  located_in
  located_in
  involved_in
  enables
  enables
  enables
  enables
  located_in
  located_in
  located_in
  located_in
  located_in
  located_in
  located_in
  located_in

9 Homologues

Type
least diverged orthologue
least diverged orthologue
least diverged orthologue
orthologue
orthologue
orthologue
orthologue
least diverged orthologue
orthologue

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00008018 10364956 10373234 1

19 Ontology Annotations

Annotation Extension Qualifier
  located_in
  enables
  enables
  located_in
  located_in
  located_in
  involved_in
  enables
  enables
  enables
  enables
  located_in
  located_in
  located_in
  located_in
  located_in
  located_in
  located_in
  located_in

0 Regulates Expr Cluster

1 Sequence

Length
8279

1 Sequence Ontology Term

Identifier Name Description
gene  

1 Strains

WormBase ID
WBStrain00002756

1 Upstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrIII_10357649..10364955   7307 III: 10357649-10364955 Caenorhabditis elegans